ID: 1037717280

View in Genome Browser
Species Human (GRCh38)
Location 8:21411127-21411149
Sequence CTGTGAGTGAGGAGCCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037717280_1037717289 25 Left 1037717280 8:21411127-21411149 CCATCGTGGCTCCTCACTCACAG No data
Right 1037717289 8:21411175-21411197 GATGAGGCTTCCTCTTATGAAGG No data
1037717280_1037717283 3 Left 1037717280 8:21411127-21411149 CCATCGTGGCTCCTCACTCACAG No data
Right 1037717283 8:21411153-21411175 GCCTGAGCTGCCCTAGACCTTGG No data
1037717280_1037717285 9 Left 1037717280 8:21411127-21411149 CCATCGTGGCTCCTCACTCACAG No data
Right 1037717285 8:21411159-21411181 GCTGCCCTAGACCTTGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037717280 Original CRISPR CTGTGAGTGAGGAGCCACGA TGG (reversed) Intergenic
No off target data available for this crispr