ID: 1037726835

View in Genome Browser
Species Human (GRCh38)
Location 8:21489804-21489826
Sequence CAGTAGTCACTAGCCACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037726835_1037726837 -1 Left 1037726835 8:21489804-21489826 CCACATGTGGCTAGTGACTACTG No data
Right 1037726837 8:21489826-21489848 GTATTGGCTAGCACTGTGTAAGG No data
1037726835_1037726838 0 Left 1037726835 8:21489804-21489826 CCACATGTGGCTAGTGACTACTG No data
Right 1037726838 8:21489827-21489849 TATTGGCTAGCACTGTGTAAGGG No data
1037726835_1037726839 3 Left 1037726835 8:21489804-21489826 CCACATGTGGCTAGTGACTACTG No data
Right 1037726839 8:21489830-21489852 TGGCTAGCACTGTGTAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037726835 Original CRISPR CAGTAGTCACTAGCCACATG TGG (reversed) Intergenic
No off target data available for this crispr