ID: 1037726839

View in Genome Browser
Species Human (GRCh38)
Location 8:21489830-21489852
Sequence TGGCTAGCACTGTGTAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037726835_1037726839 3 Left 1037726835 8:21489804-21489826 CCACATGTGGCTAGTGACTACTG No data
Right 1037726839 8:21489830-21489852 TGGCTAGCACTGTGTAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037726839 Original CRISPR TGGCTAGCACTGTGTAAGGG TGG Intergenic
No off target data available for this crispr