ID: 1037727401

View in Genome Browser
Species Human (GRCh38)
Location 8:21494426-21494448
Sequence AGGTGGGCCCCTTTTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037727395_1037727401 23 Left 1037727395 8:21494380-21494402 CCCTCTCAAGATTCTCTTCTGCT No data
Right 1037727401 8:21494426-21494448 AGGTGGGCCCCTTTTTCCTCAGG No data
1037727393_1037727401 28 Left 1037727393 8:21494375-21494397 CCCTGCCCTCTCAAGATTCTCTT No data
Right 1037727401 8:21494426-21494448 AGGTGGGCCCCTTTTTCCTCAGG No data
1037727394_1037727401 27 Left 1037727394 8:21494376-21494398 CCTGCCCTCTCAAGATTCTCTTC No data
Right 1037727401 8:21494426-21494448 AGGTGGGCCCCTTTTTCCTCAGG No data
1037727396_1037727401 22 Left 1037727396 8:21494381-21494403 CCTCTCAAGATTCTCTTCTGCTT No data
Right 1037727401 8:21494426-21494448 AGGTGGGCCCCTTTTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037727401 Original CRISPR AGGTGGGCCCCTTTTTCCTC AGG Intergenic
No off target data available for this crispr