ID: 1037728010

View in Genome Browser
Species Human (GRCh38)
Location 8:21499683-21499705
Sequence CGTCCGTGGCACAAAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037728009_1037728010 -10 Left 1037728009 8:21499670-21499692 CCTGACTGTCAAGCGTCCGTGGC No data
Right 1037728010 8:21499683-21499705 CGTCCGTGGCACAAAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037728010 Original CRISPR CGTCCGTGGCACAAAATAAA AGG Intergenic
No off target data available for this crispr