ID: 1037729821

View in Genome Browser
Species Human (GRCh38)
Location 8:21515024-21515046
Sequence CTCAGTCAGCATTTTTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037729821_1037729825 -9 Left 1037729821 8:21515024-21515046 CCCAGATAAAAATGCTGACTGAG No data
Right 1037729825 8:21515038-21515060 CTGACTGAGATTTTGTGGGCAGG No data
1037729821_1037729826 -4 Left 1037729821 8:21515024-21515046 CCCAGATAAAAATGCTGACTGAG No data
Right 1037729826 8:21515043-21515065 TGAGATTTTGTGGGCAGGAAAGG No data
1037729821_1037729832 30 Left 1037729821 8:21515024-21515046 CCCAGATAAAAATGCTGACTGAG No data
Right 1037729832 8:21515077-21515099 CCAGAAAAGATATCTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037729821 Original CRISPR CTCAGTCAGCATTTTTATCT GGG (reversed) Intergenic
No off target data available for this crispr