ID: 1037731717

View in Genome Browser
Species Human (GRCh38)
Location 8:21531169-21531191
Sequence CCCAGGTTGACTCCTACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037731717_1037731722 -5 Left 1037731717 8:21531169-21531191 CCAGTAGTAGGAGTCAACCTGGG No data
Right 1037731722 8:21531187-21531209 CTGGGTGCACATCACTGGGAAGG No data
1037731717_1037731719 -10 Left 1037731717 8:21531169-21531191 CCAGTAGTAGGAGTCAACCTGGG No data
Right 1037731719 8:21531182-21531204 TCAACCTGGGTGCACATCACTGG No data
1037731717_1037731723 30 Left 1037731717 8:21531169-21531191 CCAGTAGTAGGAGTCAACCTGGG No data
Right 1037731723 8:21531222-21531244 ATGTTGTAATTATTCACCATAGG No data
1037731717_1037731720 -9 Left 1037731717 8:21531169-21531191 CCAGTAGTAGGAGTCAACCTGGG No data
Right 1037731720 8:21531183-21531205 CAACCTGGGTGCACATCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037731717 Original CRISPR CCCAGGTTGACTCCTACTAC TGG (reversed) Intergenic
No off target data available for this crispr