ID: 1037733149

View in Genome Browser
Species Human (GRCh38)
Location 8:21546116-21546138
Sequence ATGGGGATGCAGGAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037733140_1037733149 14 Left 1037733140 8:21546079-21546101 CCTTCAGTTCTCCTAAAATTATC No data
Right 1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG No data
1037733139_1037733149 15 Left 1037733139 8:21546078-21546100 CCCTTCAGTTCTCCTAAAATTAT No data
Right 1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG No data
1037733145_1037733149 -10 Left 1037733145 8:21546103-21546125 CCTGTCAAGTTTTATGGGGATGC No data
Right 1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG No data
1037733141_1037733149 3 Left 1037733141 8:21546090-21546112 CCTAAAATTATCTCCTGTCAAGT No data
Right 1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037733149 Original CRISPR ATGGGGATGCAGGAGAAGGA GGG Intergenic
No off target data available for this crispr