ID: 1037736876

View in Genome Browser
Species Human (GRCh38)
Location 8:21574451-21574473
Sequence AGCTCATGACTCATCACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037736876_1037736880 4 Left 1037736876 8:21574451-21574473 CCTCCAGTGATGAGTCATGAGCT No data
Right 1037736880 8:21574478-21574500 GAATTGTCTTTCTGCAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037736876 Original CRISPR AGCTCATGACTCATCACTGG AGG (reversed) Intergenic
No off target data available for this crispr