ID: 1037736880

View in Genome Browser
Species Human (GRCh38)
Location 8:21574478-21574500
Sequence GAATTGTCTTTCTGCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037736878_1037736880 1 Left 1037736878 8:21574454-21574476 CCAGTGATGAGTCATGAGCTGGA No data
Right 1037736880 8:21574478-21574500 GAATTGTCTTTCTGCAAAACTGG No data
1037736876_1037736880 4 Left 1037736876 8:21574451-21574473 CCTCCAGTGATGAGTCATGAGCT No data
Right 1037736880 8:21574478-21574500 GAATTGTCTTTCTGCAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037736880 Original CRISPR GAATTGTCTTTCTGCAAAAC TGG Intergenic
No off target data available for this crispr