ID: 1037740187

View in Genome Browser
Species Human (GRCh38)
Location 8:21602648-21602670
Sequence ATGGGCTGGCTTTCATTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037740181_1037740187 10 Left 1037740181 8:21602615-21602637 CCGTACCCTTCATTCAGTTTATC No data
Right 1037740187 8:21602648-21602670 ATGGGCTGGCTTTCATTTCCAGG No data
1037740183_1037740187 4 Left 1037740183 8:21602621-21602643 CCTTCATTCAGTTTATCAGTGAC No data
Right 1037740187 8:21602648-21602670 ATGGGCTGGCTTTCATTTCCAGG No data
1037740180_1037740187 11 Left 1037740180 8:21602614-21602636 CCCGTACCCTTCATTCAGTTTAT No data
Right 1037740187 8:21602648-21602670 ATGGGCTGGCTTTCATTTCCAGG No data
1037740182_1037740187 5 Left 1037740182 8:21602620-21602642 CCCTTCATTCAGTTTATCAGTGA No data
Right 1037740187 8:21602648-21602670 ATGGGCTGGCTTTCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037740187 Original CRISPR ATGGGCTGGCTTTCATTTCC AGG Intergenic
No off target data available for this crispr