ID: 1037741366

View in Genome Browser
Species Human (GRCh38)
Location 8:21611768-21611790
Sequence GGTCATGCTTAGATCCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037741359_1037741366 22 Left 1037741359 8:21611723-21611745 CCACAGGACATAGCAGCACCGTG No data
Right 1037741366 8:21611768-21611790 GGTCATGCTTAGATCCTGAGTGG No data
1037741363_1037741366 4 Left 1037741363 8:21611741-21611763 CCGTGTCAGGGGCTGTAGCAACT No data
Right 1037741366 8:21611768-21611790 GGTCATGCTTAGATCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037741366 Original CRISPR GGTCATGCTTAGATCCTGAG TGG Intergenic
No off target data available for this crispr