ID: 1037747551

View in Genome Browser
Species Human (GRCh38)
Location 8:21659043-21659065
Sequence CAGTGGAGCTGGAGTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037747551_1037747557 -4 Left 1037747551 8:21659043-21659065 CCCTCTCCACTCCAGCTCCACTG No data
Right 1037747557 8:21659062-21659084 ACTGCTGTTCTTCACACAGTGGG No data
1037747551_1037747560 15 Left 1037747551 8:21659043-21659065 CCCTCTCCACTCCAGCTCCACTG No data
Right 1037747560 8:21659081-21659103 TGGGGCATGCTGCAACCTTAGGG No data
1037747551_1037747558 -3 Left 1037747551 8:21659043-21659065 CCCTCTCCACTCCAGCTCCACTG No data
Right 1037747558 8:21659063-21659085 CTGCTGTTCTTCACACAGTGGGG No data
1037747551_1037747559 14 Left 1037747551 8:21659043-21659065 CCCTCTCCACTCCAGCTCCACTG No data
Right 1037747559 8:21659080-21659102 GTGGGGCATGCTGCAACCTTAGG No data
1037747551_1037747556 -5 Left 1037747551 8:21659043-21659065 CCCTCTCCACTCCAGCTCCACTG No data
Right 1037747556 8:21659061-21659083 CACTGCTGTTCTTCACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037747551 Original CRISPR CAGTGGAGCTGGAGTGGAGA GGG (reversed) Intergenic
No off target data available for this crispr