ID: 1037749632

View in Genome Browser
Species Human (GRCh38)
Location 8:21672803-21672825
Sequence ATACAAGCCACTATCTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037749632_1037749636 -9 Left 1037749632 8:21672803-21672825 CCCCCATAGATAGTGGCTTGTAT No data
Right 1037749636 8:21672817-21672839 GGCTTGTATCTGTCCTCACATGG No data
1037749632_1037749638 0 Left 1037749632 8:21672803-21672825 CCCCCATAGATAGTGGCTTGTAT No data
Right 1037749638 8:21672826-21672848 CTGTCCTCACATGGCAGAAAGGG No data
1037749632_1037749641 30 Left 1037749632 8:21672803-21672825 CCCCCATAGATAGTGGCTTGTAT No data
Right 1037749641 8:21672856-21672878 CTCCCTCAAACCTCTTTATAAGG No data
1037749632_1037749637 -1 Left 1037749632 8:21672803-21672825 CCCCCATAGATAGTGGCTTGTAT No data
Right 1037749637 8:21672825-21672847 TCTGTCCTCACATGGCAGAAAGG 0: 7
1: 188
2: 551
3: 1189
4: 1950
1037749632_1037749640 4 Left 1037749632 8:21672803-21672825 CCCCCATAGATAGTGGCTTGTAT No data
Right 1037749640 8:21672830-21672852 CCTCACATGGCAGAAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037749632 Original CRISPR ATACAAGCCACTATCTATGG GGG (reversed) Intergenic
No off target data available for this crispr