ID: 1037751193

View in Genome Browser
Species Human (GRCh38)
Location 8:21683448-21683470
Sequence CTTCATATCAAGATGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037751181_1037751193 22 Left 1037751181 8:21683403-21683425 CCCGGTGCTTTTTCTAGACCTGT No data
Right 1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG No data
1037751187_1037751193 -1 Left 1037751187 8:21683426-21683448 CCTCTCCAAGGCTGCCCTGGGAC No data
Right 1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG No data
1037751184_1037751193 4 Left 1037751184 8:21683421-21683443 CCTGTCCTCTCCAAGGCTGCCCT No data
Right 1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG No data
1037751182_1037751193 21 Left 1037751182 8:21683404-21683426 CCGGTGCTTTTTCTAGACCTGTC No data
Right 1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG No data
1037751188_1037751193 -6 Left 1037751188 8:21683431-21683453 CCAAGGCTGCCCTGGGACTTCAT No data
Right 1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037751193 Original CRISPR CTTCATATCAAGATGCAGGA GGG Intergenic
No off target data available for this crispr