ID: 1037752333

View in Genome Browser
Species Human (GRCh38)
Location 8:21690958-21690980
Sequence AGGTCTCTGTCCAGCCATTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037752333_1037752337 9 Left 1037752333 8:21690958-21690980 CCGCAATGGCTGGACAGAGACCT 0: 1
1: 0
2: 2
3: 8
4: 173
Right 1037752337 8:21690990-21691012 ACTGTACCCCTTCCATGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 181
1037752333_1037752338 13 Left 1037752333 8:21690958-21690980 CCGCAATGGCTGGACAGAGACCT 0: 1
1: 0
2: 2
3: 8
4: 173
Right 1037752338 8:21690994-21691016 TACCCCTTCCATGCAGAGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 151
1037752333_1037752342 17 Left 1037752333 8:21690958-21690980 CCGCAATGGCTGGACAGAGACCT 0: 1
1: 0
2: 2
3: 8
4: 173
Right 1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG 0: 1
1: 0
2: 4
3: 27
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037752333 Original CRISPR AGGTCTCTGTCCAGCCATTG CGG (reversed) Exonic
900312033 1:2038226-2038248 AGACCTCTGTGCAGCCATGGAGG - Intergenic
900315885 1:2056138-2056160 ATGTCCCTTTCCAGCCATAGAGG + Intronic
902174510 1:14639122-14639144 TGGTGTCTGTCCAGCCTTTCTGG - Intronic
902453685 1:16516109-16516131 GGGTATCTGACCAGCCTTTGTGG + Intergenic
902473738 1:16668773-16668795 GGGTATCTGACCAGCCTTTGTGG + Intergenic
902485065 1:16738669-16738691 GGGTATCTGACCAGCCTTTGTGG - Intergenic
902498799 1:16894153-16894175 GGGTATCTGACCAGCCTTTGTGG - Intronic
903170028 1:21547041-21547063 AGGTAACTGACCAGCCAGTGTGG - Intronic
903207649 1:21795009-21795031 AGGTCTCTGACCAGCAAAAGTGG - Intergenic
903676034 1:25065239-25065261 AGGCCTCTGTCCAGGCATGGGGG + Intergenic
904998498 1:34649981-34650003 AGGTCACTGGCCAGGCATGGTGG + Intergenic
914005804 1:143731453-143731475 GGGTATCTGACCAGCCTTTGTGG + Intergenic
914517985 1:148390473-148390495 GGGTATCTGACCAGCCTTTGTGG + Intergenic
916000803 1:160613454-160613476 AGGTCTTTGTCCAGGAATTGTGG - Intronic
917454927 1:175178073-175178095 TGGTCTCCATCCAGCCATTCTGG - Intronic
917858080 1:179118223-179118245 AGCTCTCTGGCCAGGCATGGTGG + Intronic
918440410 1:184561057-184561079 AGGTATATTTCCAGCCTTTGTGG + Intronic
922578191 1:226677328-226677350 AGGTCTCTCCCCAGCCCTGGTGG - Intronic
923592275 1:235329048-235329070 AGTTCTCTGCCCAGCCGCTGTGG + Intronic
1063122632 10:3115408-3115430 AGGTGTGTGTCCCGCCATGGAGG + Intronic
1063122646 10:3115455-3115477 AGGTGTGTGTCCCGCCATGGAGG + Intronic
1063692251 10:8297734-8297756 AATTCTCTGTCCAGGCATGGTGG - Intergenic
1064873485 10:19965886-19965908 AGGGCACTGTCAATCCATTGAGG - Intronic
1069907882 10:71742498-71742520 AGATCTCCATCCAGCCCTTGAGG - Intronic
1072242983 10:93514560-93514582 AGGTCTCTGTCACCCCATGGGGG + Intronic
1075091899 10:119448464-119448486 AAGTCTCTGGACAGCCAATGTGG - Intronic
1075574823 10:123570734-123570756 AGGTCCCTCTCCCGCCTTTGTGG + Intergenic
1080106578 11:28517550-28517572 AGCTTTCTGTCCAGCCTTTCTGG + Intergenic
1081530905 11:43958747-43958769 AGGTTTCTGTTCAGCCCTTAGGG + Intergenic
1084463765 11:69310402-69310424 TGGTCTCTGTCCAGCCAATGTGG + Intronic
1084983763 11:72849262-72849284 AGGACGATGTCCAGCCATAGTGG - Intronic
1087401195 11:97668303-97668325 AGGTATTTGTCCAGCCAGTGCGG + Intergenic
1090175719 11:124647616-124647638 TGGTCTTTTTCCAGCCAGTGGGG + Intronic
1090918948 11:131191607-131191629 AGGTCTCAGGCCAGCCCTGGTGG + Intergenic
1091182402 11:133618713-133618735 AGGTCTGTCTTCAGCAATTGCGG + Intergenic
1092277753 12:7075026-7075048 GGGTCTCTGTCAAGCCTTTTGGG - Intergenic
1096102384 12:48977936-48977958 CCTTCTCTGTCCAGCCATCGGGG + Intergenic
1099620316 12:84995622-84995644 AGGTCTCTCTGCAGCCATCTCGG + Intergenic
1101414732 12:104499303-104499325 AGGCCTGTGACCAGCCAGTGGGG + Intronic
1102722031 12:115024742-115024764 ATGTCTTTGTCTAGCTATTGTGG - Intergenic
1102799807 12:115722278-115722300 AGGTGTCTCTCAAGCCAGTGAGG + Intergenic
1104427300 12:128688125-128688147 AGGCCACTGTCCAGCAACTGTGG - Intronic
1104726114 12:131076654-131076676 ATGTCTATCTCCATCCATTGTGG - Intronic
1106272305 13:28166639-28166661 AGTTCTCTGTCTAGCCCCTGAGG + Intronic
1111589215 13:90322437-90322459 AAGTCCCTGTCCAGGCAGTGGGG + Intergenic
1112623578 13:101077811-101077833 AGGTCTCTGGCATGCCCTTGGGG - Intronic
1113024147 13:105921885-105921907 AGGACTCTGGCCGGGCATTGTGG - Intergenic
1114527434 14:23375617-23375639 AAGTCTCTGTCCAACCTGTGGGG - Exonic
1117533061 14:56677410-56677432 CTGTCTCTGTGCAGCCACTGGGG - Intronic
1118962025 14:70542649-70542671 AGGCCTATGTCCAGGCATGGTGG + Intergenic
1120521902 14:85533956-85533978 AGGTCTCCTTCCAGCCCTGGTGG - Intronic
1121862001 14:97327151-97327173 AAGTCTGTGGCCAGCCACTGTGG - Intergenic
1122596347 14:102895620-102895642 GTGTCTCTGTCTATCCATTGGGG - Intronic
1123782219 15:23639834-23639856 AGGCCCCTGTGCAGCCAATGTGG + Intergenic
1129382783 15:75178500-75178522 GGGGCTCCGTCCAGCCGTTGGGG + Intergenic
1129920054 15:79311926-79311948 AGGGATCAGTGCAGCCATTGAGG + Intronic
1131898501 15:97061326-97061348 AGGTGTCTGTCTAGTCACTGCGG - Intergenic
1131946116 15:97623817-97623839 AGGCCTGTGTCCTGCCAGTGTGG + Intergenic
1132669053 16:1095281-1095303 AGGGCTCTGCCCAGCCACAGTGG - Intronic
1132809980 16:1792850-1792872 AGCTCCCTGTCCAGCCTCTGAGG - Intronic
1135135248 16:19882568-19882590 GGGGCTCTGTCCAGCCTTGGGGG - Intronic
1138069658 16:53980337-53980359 AGGTCTCTTTCCAGCCATTCTGG - Intronic
1138276963 16:55742087-55742109 AGGTGTCTGCCAAGCCAGTGTGG - Intergenic
1139428753 16:66899910-66899932 ATCTCTTTGTCCAGCCCTTGAGG - Intergenic
1140347960 16:74233389-74233411 AGGCCTCTGGCCAGGCATGGTGG + Intergenic
1142904941 17:3035217-3035239 AGGCCTCTTTCCAGCCGTGGGGG - Exonic
1143054275 17:4151173-4151195 AAGTTTGTGTCCATCCATTGTGG + Intronic
1144056177 17:11542857-11542879 AGGTCTCTCTGAAGCCATTTTGG - Intronic
1147628254 17:41913867-41913889 AGGTCTCTCTGCAGCCATGTCGG - Exonic
1147648025 17:42045606-42045628 GGGTCTCAGTACAGCCTTTGGGG - Intronic
1147667901 17:42160207-42160229 AGTTCACTGCCCAGCCAGTGTGG - Exonic
1148628287 17:49087242-49087264 AAGTCTCTGGCCAGGCATGGTGG + Intergenic
1149475076 17:56954118-56954140 AAGTCTCTGTTCAGTCACTGTGG + Intronic
1149623168 17:58061049-58061071 GGGTCTCTGTCCTGCCTCTGGGG - Intergenic
1150135249 17:62691870-62691892 AGGTCTCAGCCCAGCCCTCGTGG - Intronic
1150135422 17:62692622-62692644 GGGTCTCAGCCCAGCCCTTGTGG - Exonic
1152584367 17:81182412-81182434 AGGCCTGTGGCCAGCCACTGGGG - Intergenic
1153138161 18:1941520-1941542 AGGTTTCTGTGTAGCCACTGAGG - Intergenic
1154148710 18:11888410-11888432 ATGACTCTGCCCAGCCACTGTGG - Intronic
1156585158 18:38423833-38423855 GGGTCTCCGTCCCCCCATTGTGG + Intergenic
1156940423 18:42760304-42760326 TGCTGTGTGTCCAGCCATTGAGG - Intronic
1157309441 18:46541302-46541324 AGGGCCCTTTCAAGCCATTGTGG + Intronic
1161217802 19:3103144-3103166 AGGTCTCAGCCCTGCCACTGGGG + Intronic
1162719976 19:12656576-12656598 TGGGCACTGTCCTGCCATTGGGG + Exonic
1162770043 19:12943923-12943945 AGGCCTCAGTCCAGCCCTGGAGG - Exonic
1165548340 19:36561546-36561568 AGGTCTCTGTCTAGGCCCTGAGG - Intronic
1166637456 19:44463185-44463207 AGGTCTCTGTCTACCCACTTTGG + Intergenic
1166726477 19:45031410-45031432 AGGTGCCTGTCCAGGCATAGTGG - Intronic
1166995468 19:46717664-46717686 AGGTCTGTCTCCAGCGATGGTGG + Intergenic
1168634982 19:57989172-57989194 AGTTGTCTTTCCAGCCATGGTGG + Intronic
1202705931 1_KI270713v1_random:23848-23870 GGGTATCTGACCAGCCTTTGTGG + Intergenic
925488828 2:4369106-4369128 AGGCGTCGGTCCAGCCGTTGTGG - Intergenic
927651200 2:24914744-24914766 AGGTCTCTGCCCACCCAAGGTGG + Intronic
929496260 2:42446851-42446873 AGGTCTCAGGCCAGGCATGGTGG + Intronic
929607484 2:43244628-43244650 TGGGCCCTGTCCAGCCATTTTGG + Intronic
930063971 2:47313499-47313521 ATGTCTCAGTTCAGGCATTGAGG - Intergenic
931630261 2:64292212-64292234 AGGTGTCTGGCCAGGCATGGTGG + Intergenic
932006539 2:67933287-67933309 AGATCTCTGACCAGCCTTTCGGG - Intergenic
932197412 2:69796548-69796570 AGGTCTCTGTCTACCTATTAGGG + Intronic
933847291 2:86336696-86336718 AGGTCTGTGTGAAGTCATTGGGG - Intronic
937438326 2:121897153-121897175 AGGTCTCCCTCCAGCCAGTCTGG + Intergenic
937911619 2:127078308-127078330 GGGTCTCTGTCCTGACATGGGGG + Intronic
940545623 2:155079770-155079792 AAGTCACAGTCCAGCTATTGAGG - Intergenic
942882808 2:180883183-180883205 AGGTCTGTGTCCTGCCTTGGGGG + Intergenic
943485383 2:188473342-188473364 AGGCCTCTGTCCTTCCATTCAGG + Intronic
947266515 2:228288257-228288279 GGCTCTTTATCCAGCCATTGTGG + Intergenic
947407617 2:229796483-229796505 AGGTCTTGGTCAAGACATTGAGG - Intronic
948281412 2:236750280-236750302 GGGCCTCTCTCCACCCATTGTGG - Intergenic
948281425 2:236750338-236750360 GGGTCTCTCTCCACCCAGTGTGG - Intergenic
948281438 2:236750396-236750418 GGGTCTCTCTCCACCCAGTGTGG - Intergenic
948711037 2:239825725-239825747 AGGCCTCTCTCCAGCCTCTGGGG - Intergenic
1170119958 20:12900966-12900988 TGGTCTCTGTCGAGCCACCGAGG + Intergenic
1176121940 20:63457999-63458021 GGGTCTCTGTCCAGCACCTGTGG - Intronic
1177946721 21:27479654-27479676 AGGTCTCTGCCCAGACCTCGAGG + Intergenic
1178761382 21:35405898-35405920 AGATCTCTGCTCAGCCACTGTGG - Intronic
1180004205 21:45012529-45012551 AGGTCACTTTCCAGGGATTGGGG + Intergenic
1180131766 21:45831164-45831186 AGGTGTCTGTCCAGGCCATGAGG + Intronic
1181765213 22:25086709-25086731 AGCTCTCTGGCCGGCCTTTGGGG - Intronic
1181855010 22:25775186-25775208 AAGGCTGTGTCCAGCCAGTGTGG + Intronic
1182620751 22:31617187-31617209 TGGTCTCGGTCTAGCCATGGAGG + Intronic
1183980778 22:41538822-41538844 GTGTCTGTGTCCAGCCATTCAGG - Intronic
1184511696 22:44937320-44937342 CCGTCTCTGCCCAGCCTTTGAGG - Intronic
1185417545 22:50718606-50718628 ATTTCTCTGTCCAGCGGTTGGGG + Intergenic
952865201 3:37850545-37850567 AGGTCACTGGCCAGTCAATGGGG - Intergenic
952929482 3:38347951-38347973 AGGCCTCTGGCCAGTCCTTGGGG + Intronic
953071158 3:39521236-39521258 AGCTGTCTGGCCAGGCATTGTGG - Intronic
953660721 3:44889709-44889731 AGGCCTCTATCCAGCCTTTTAGG - Intronic
955221303 3:57025643-57025665 AGGCCTCCCTCCAGCCATTCAGG + Intronic
956304013 3:67804583-67804605 AGGTCTCTGTACTGGCAGTGAGG + Intergenic
966975096 3:185076084-185076106 AGGTCCCTGTTCAGACATTGTGG + Intergenic
967879851 3:194293834-194293856 AGGTCTCCATCCAGCCTTTTTGG + Intergenic
968045897 3:195623860-195623882 AGGTCTCTGCTCAGCCCTGGGGG + Intergenic
968288569 3:197522195-197522217 AGGGGTCAGTCCAGCCATGGGGG - Intronic
968308757 3:197666227-197666249 AGGTCTCTGCTCAGCCCTGGGGG - Intergenic
969463774 4:7342937-7342959 AGGTCTCTGTCCTGGCTGTGTGG + Intronic
976312395 4:83624777-83624799 AGTTCTCTAACCAGCCAGTGTGG - Intergenic
978478506 4:109160723-109160745 AGGTCACTGGCCATCCCTTGGGG - Intronic
984041803 4:174744244-174744266 AGGTCCCTGAGCAGCCAGTGTGG - Intronic
986447769 5:7837812-7837834 AGGCCCCTGGCCAGCCACTGCGG + Intronic
987533001 5:19145029-19145051 AGGTATCTGGCCAGACATGGTGG - Intergenic
988605379 5:32674451-32674473 AGGTGTCTGTCCAGTTAGTGGGG + Intergenic
988786033 5:34566061-34566083 AGAGCTCAGTCCAGCTATTGTGG + Intergenic
989061308 5:37414631-37414653 AGGTATCTGTCAAGCCACTGAGG - Intronic
992115452 5:73534694-73534716 TGGTTTCTGTTCAGCCCTTGTGG + Intergenic
993096803 5:83488454-83488476 AGGTCTCTCACCAGCCATCTGGG + Intronic
996133319 5:119809002-119809024 AGGTCTCTGTCCTTCCCTTCAGG + Intergenic
997997435 5:138597858-138597880 AGGGCTCTCTACAGCCATTTGGG - Intergenic
998168250 5:139856621-139856643 AGGGCTCTGCCAAGGCATTGAGG - Intronic
998392630 5:141797187-141797209 GGGTATGTGTCCAGGCATTGAGG - Intergenic
998641652 5:144018477-144018499 AGGTCAGTGCCCAGCAATTGTGG - Intergenic
1001601184 5:172929670-172929692 ACGTCAGTGTCCAGCCATAGGGG + Intronic
1004679589 6:17880241-17880263 CGGTTTCTGGCCAGCCATGGTGG - Intronic
1006273984 6:32986501-32986523 AACTCCCTGTTCAGCCATTGAGG + Intergenic
1008158470 6:48047329-48047351 AAGTCTATGTGCAACCATTGTGG - Intronic
1009656882 6:66558658-66558680 AGTTCTCTGTCCAGGGAGTGGGG + Intergenic
1015186813 6:130426498-130426520 AGATCTCTGTCCAGCCTCTGTGG + Intronic
1018143326 6:160861324-160861346 GGGTCTCTGTGCAGCAGTTGCGG + Intergenic
1019447766 7:1080309-1080331 CGGTCTGTGTCCCGCCATCGTGG - Intronic
1019704369 7:2490408-2490430 AAGTCTCTGTCTCCCCATTGTGG - Intergenic
1021765545 7:23944366-23944388 AGGCCTCTGTGCAGCCAGTGTGG - Intergenic
1024001603 7:45193522-45193544 AGGGCTCTGACCAGTCAATGGGG + Intergenic
1025110658 7:56213460-56213482 AGGTTTGTGTCCATCCAGTGAGG + Intergenic
1026307268 7:69152961-69152983 AGGTTTCTATCCATCCAGTGAGG - Intergenic
1026370573 7:69694489-69694511 AGCTCTATGGCCAGCCATGGTGG + Intronic
1030100357 7:105940405-105940427 AGGACTCTGTCCAGGCCTGGGGG + Intronic
1034431329 7:151042678-151042700 AGGTCTTTTTCCAGCCTTCGGGG + Intronic
1034737021 7:153438973-153438995 AAGTCTCTGTCATGCCATGGCGG + Intergenic
1037752333 8:21690958-21690980 AGGTCTCTGTCCAGCCATTGCGG - Exonic
1039848599 8:41343454-41343476 AGGTCCCTGTCCACCCACAGGGG - Intergenic
1042738209 8:72012493-72012515 AGATCTCTGGCCAGTCATGGTGG - Intronic
1046116900 8:109795682-109795704 GAGTCTCTGTCAAGCCCTTGAGG - Intergenic
1048855882 8:138686304-138686326 AGGGCTCTGAACAGCCCTTGTGG + Intronic
1053258272 9:36638048-36638070 ATGCCTGTGTTCAGCCATTGGGG + Intronic
1055498530 9:76880198-76880220 AGGCCTCTGGCCAGGCATGGTGG - Intronic
1056836548 9:89960413-89960435 GGGTCTCTGTGCAGCCCCTGTGG + Intergenic
1057962017 9:99465889-99465911 AGGTCTCAGACCAGGCCTTGTGG - Intergenic
1058592301 9:106577908-106577930 AGGTCTCCTTCAAGCCTTTGTGG - Intergenic
1058890162 9:109354540-109354562 AGGGCTCTGTGGAGCCATGGTGG - Intergenic
1059149341 9:111935047-111935069 AGAAGTCTGTCCAGCCATTTTGG - Exonic
1061314420 9:129785784-129785806 AGGTATTTGTACAGCCAGTGAGG - Intergenic
1062618680 9:137409563-137409585 AGGTATCTATCCAGGCATGGTGG + Intronic
1192338337 X:70240248-70240270 GGGTCTCTGAGCAGCCATAGTGG - Exonic
1196857890 X:120000542-120000564 ATGTCTCTGTCCAGCCCTCCAGG + Intergenic
1196859779 X:120015925-120015947 ACGTCTCTGTCCAGCCATCCAGG + Intergenic