ID: 1037752336

View in Genome Browser
Species Human (GRCh38)
Location 8:21690978-21691000
Sequence AGGGGTACAGTGAGCCAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037752336_1037752342 -3 Left 1037752336 8:21690978-21691000 CCTGGCTGGCTCACTGTACCCCT 0: 1
1: 0
2: 3
3: 32
4: 246
Right 1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG 0: 1
1: 0
2: 4
3: 27
4: 266
1037752336_1037752338 -7 Left 1037752336 8:21690978-21691000 CCTGGCTGGCTCACTGTACCCCT 0: 1
1: 0
2: 3
3: 32
4: 246
Right 1037752338 8:21690994-21691016 TACCCCTTCCATGCAGAGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 151
1037752336_1037752345 29 Left 1037752336 8:21690978-21691000 CCTGGCTGGCTCACTGTACCCCT 0: 1
1: 0
2: 3
3: 32
4: 246
Right 1037752345 8:21691030-21691052 ACAGTGATAAACGCTGTGAACGG 0: 1
1: 0
2: 1
3: 18
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037752336 Original CRISPR AGGGGTACAGTGAGCCAGCC AGG (reversed) Exonic
900438970 1:2643964-2643986 AGGGCCAGACTGAGCCAGCCAGG - Intronic
901049931 1:6420896-6420918 AGGGATCCACAGAGCCAGCCAGG + Intronic
903179741 1:21599175-21599197 AGGGGTGCAGTGAGCCTGGGAGG + Intronic
903369630 1:22826860-22826882 GGGGACACAGTGAGCCAGACTGG - Intronic
903571153 1:24306472-24306494 AAGGCAACAGGGAGCCAGCCAGG + Intergenic
905732121 1:40304492-40304514 AGGGGTCCAGTGGGGCAACCAGG - Exonic
906300614 1:44678719-44678741 GTGGGGACAGTGAGCCAGGCTGG + Intronic
906416769 1:45626060-45626082 AGGGCTACAGTGAGCCATGATGG - Intergenic
906568296 1:46815867-46815889 AGGGGAACAGGCAGCCAGCAAGG - Intronic
907501326 1:54883700-54883722 AGTGAGACAGTGAGCCAGCCAGG + Exonic
908548189 1:65182716-65182738 AGGGTTACAGAAAGCCAACCAGG - Intronic
909593758 1:77381205-77381227 AAGGGTAAAGTGAGCCATCTGGG - Intronic
910734796 1:90441738-90441760 GAGGTTGCAGTGAGCCAGCCTGG + Intergenic
914741374 1:150468095-150468117 GAGGTTGCAGTGAGCCAGCCTGG + Intronic
915724241 1:158006641-158006663 AAGGGCACAGTGACTCAGCCAGG - Intronic
916870061 1:168903977-168903999 AGGGGTACAGTAATGGAGCCAGG + Intergenic
917094430 1:171385923-171385945 AGGGGAACAGTGGGCCGGGCGGG - Intergenic
919148947 1:193670602-193670624 ATGGGTACAGTAAGCCAACATGG - Intergenic
919682637 1:200451696-200451718 ATGGGTGCAGCGAGCCAGCATGG - Intergenic
920867748 1:209767622-209767644 AGGAGTACAGTGGTGCAGCCTGG - Intronic
921285076 1:213602296-213602318 GAGGTTGCAGTGAGCCAGCCTGG - Intergenic
923513113 1:234670485-234670507 AGGGATTCAGCCAGCCAGCCTGG - Intergenic
924558099 1:245134467-245134489 AGGGATACTGACAGCCAGCCTGG - Intergenic
1063381246 10:5587627-5587649 AGGGGAACTCAGAGCCAGCCCGG - Intergenic
1064175748 10:13073543-13073565 GAGGTTGCAGTGAGCCAGCCTGG - Intronic
1065763108 10:29001645-29001667 AAGGCTGCAGTGAGCCAGCATGG - Intergenic
1067304397 10:45047447-45047469 AGGGTTTCACTGTGCCAGCCAGG - Intergenic
1069470863 10:68688159-68688181 AGGGTTACAGTGAGCCAAGATGG - Intronic
1069487749 10:68835385-68835407 AAGGCTTCAGTGAGCTAGCCTGG - Intronic
1070831742 10:79422130-79422152 AGGGGTATGGTGGGCCAGCTGGG - Intronic
1072717343 10:97760619-97760641 AGGGGTCCAGAGAGGCAGGCTGG + Exonic
1072846175 10:98832863-98832885 AGGGATACAGGCAGCAAGCCTGG + Intronic
1072891747 10:99330275-99330297 AGGTGTACAGCCAGCCAGCCAGG - Exonic
1075541678 10:123318930-123318952 AGCGGTAGAGAGAGTCAGCCAGG + Intergenic
1076499456 10:130924757-130924779 AGAGGGACAGAGAGCCAGTCAGG + Intergenic
1076766180 10:132634825-132634847 AGGGCTGCGGTGAGCCAGGCAGG - Intronic
1077008695 11:370564-370586 GGGGTCACGGTGAGCCAGCCGGG + Intronic
1077216709 11:1398086-1398108 GGGGGCACAGGGAGCCTGCCTGG + Intronic
1077410364 11:2400992-2401014 AGGGGCACCGAGAGCCAGCTTGG + Intronic
1077995536 11:7449277-7449299 ACAGTTGCAGTGAGCCAGCCTGG + Intronic
1078957830 11:16222275-16222297 AGGGCTACAGTGAGCTATCATGG - Intronic
1079592157 11:22193565-22193587 AGGGGTGCAGGCAGCCAGCCTGG - Intronic
1083245375 11:61423060-61423082 GAGGTTGCAGTGAGCCAGCCTGG + Intronic
1084517473 11:69644539-69644561 AGGGGTGCCGGCAGCCAGCCGGG + Intronic
1084890625 11:72235224-72235246 AGGGGAACAGGAAGCCAGACAGG + Intronic
1085596094 11:77811565-77811587 ACGGGTACAGTGAGCAGGCAAGG + Intronic
1086918511 11:92558742-92558764 AGGAGTACAGTTTTCCAGCCAGG - Intronic
1087263980 11:96041434-96041456 GAGGTTACAGTGAGCCAGCCTGG + Intronic
1087991283 11:104747214-104747236 AGGGGGCCAGTGTGACAGCCTGG - Intergenic
1088548644 11:110987742-110987764 GAGGTTGCAGTGAGCCAGCCTGG - Intergenic
1090797691 11:130149245-130149267 GAGGCTGCAGTGAGCCAGCCTGG - Intergenic
1090998603 11:131889333-131889355 AGGGGACCAGAGGGCCAGCCTGG + Intronic
1092285734 12:7128440-7128462 AGGGGTGCTGCTAGCCAGCCAGG + Intronic
1092784340 12:12014077-12014099 AGGACTCCAGTGAGACAGCCAGG - Intergenic
1093047828 12:14470549-14470571 AGGTCTACAGTCAGACAGCCTGG + Intronic
1095096536 12:38152330-38152352 AGGGGTATGTTGAGGCAGCCCGG + Intergenic
1096586837 12:52628350-52628372 AGGGTGAAAGTGTGCCAGCCCGG - Intergenic
1097701839 12:62828267-62828289 AGGAGTGGAGTGAGCCAGTCGGG - Intronic
1098249627 12:68555953-68555975 AAGGTTGCAGTAAGCCAGCCTGG - Intergenic
1100356779 12:93838457-93838479 AGGGGTACCGTGAGACAGCTGGG + Intronic
1101162559 12:101993969-101993991 AGAGGTACAGTCTGCGAGCCAGG + Intronic
1101586855 12:106092451-106092473 GAGGTTGCAGTGAGCCAGCCTGG + Intronic
1102207200 12:111098779-111098801 AGGAGGACAGTGAGCCACGCTGG + Intronic
1102260662 12:111441313-111441335 GAGGCTGCAGTGAGCCAGCCTGG + Intronic
1102423993 12:112826181-112826203 AGGGATAGAGAGAGCCAGACAGG + Intronic
1104211735 12:126695324-126695346 ACAGGTACACTGAGCCAGCCTGG - Intergenic
1104917723 12:132274456-132274478 AGGGGTGCAAAGAGCAAGCCGGG - Intronic
1107256027 13:38427599-38427621 AGTGGTGCAGTTAGACAGCCAGG - Intergenic
1108083035 13:46756964-46756986 AGGGGCACTGGGAGCCAGCAGGG + Intergenic
1110052671 13:70923963-70923985 AAGGGTACAGTGAGTCAGCCTGG + Intergenic
1113641044 13:111956776-111956798 AGGAGGACCGTGAGCCTGCCTGG - Intergenic
1114585558 14:23809902-23809924 ATGGGTGCAGTGGGCCAGCATGG + Intergenic
1119521318 14:75288033-75288055 GAGGTTGCAGTGAGCCAGCCTGG - Intergenic
1119664528 14:76475167-76475189 AAGGATGCAGAGAGCCAGCCTGG + Intronic
1121302981 14:92886653-92886675 AGGGGACCAGTGAGCCAGCTGGG - Intergenic
1121776999 14:96597874-96597896 AGGGGTCCATGGAGCCTGCCAGG + Intergenic
1122546911 14:102528081-102528103 AAGGCTACAGTGACTCAGCCTGG - Intergenic
1122800497 14:104227021-104227043 GGTGCCACAGTGAGCCAGCCTGG + Intergenic
1123587568 15:21773044-21773066 AGGGATGCAGTGAGGGAGCCAGG + Intergenic
1123624206 15:22215609-22215631 AGGGATGCAGTGAGGGAGCCAGG + Intergenic
1123888254 15:24748987-24749009 AGGGGTAAGGGGAGCCTGCCTGG - Intergenic
1124097889 15:26666454-26666476 AGGGCTGCAGTGACCCTGCCAGG + Intronic
1124259303 15:28173917-28173939 AGGGGTACAGAGGGCCAGAGAGG + Intronic
1124317034 15:28678937-28678959 AGGGGTACAGAGGGCCAGAGAGG + Intergenic
1124381762 15:29173137-29173159 AGGGGCTCACTGAACCAGCCTGG + Intronic
1124566416 15:30818553-30818575 AGGGGTACAGAGGGCCAGAGAGG - Intergenic
1126406290 15:48326116-48326138 GAGGTTGCAGTGAGCCAGCCTGG - Intergenic
1127835615 15:62788759-62788781 ACTGGTACAGAGAGGCAGCCAGG - Intronic
1129517711 15:76166641-76166663 AGGGGTGGAGGGAGCCGGCCAGG - Intronic
1130265808 15:82402147-82402169 AAGGTTACAGTGAGCCATGCCGG - Intergenic
1130506208 15:84544768-84544790 AAGGTTACAGTGAGCCATGCCGG + Intergenic
1131368625 15:91861247-91861269 AGGTGTGGAGTGAGCAAGCCAGG + Intronic
1132748592 16:1447148-1447170 GGGGGTGCAGGGAGCCAGCTTGG - Intronic
1132881495 16:2163569-2163591 AGGAGTAGAGGGAGCCAGGCAGG + Intronic
1136348460 16:29692055-29692077 AGGGGAACACAGAGCCAGCGAGG - Intronic
1138414235 16:56862236-56862258 AGGGACAGAGTGAGCCAGCCAGG + Intergenic
1138446479 16:57067383-57067405 AAGGTCACAGTGAGCCAACCTGG - Exonic
1139318553 16:66094273-66094295 AGGGAGAGAGTGAGCCAGGCAGG - Intergenic
1139601894 16:67992339-67992361 GAGGCTACAGTGAGCCAGCTTGG - Intronic
1140274100 16:73493573-73493595 CCAGGTACAGTGGGCCAGCCTGG - Intergenic
1140934599 16:79658684-79658706 AGGGGTGCACTGAGCTGGCCAGG - Intergenic
1141085425 16:81091669-81091691 AGGGGTAAAATGAGCCAGTGAGG - Intronic
1142413578 16:89928715-89928737 AGGGTTTCACTGTGCCAGCCAGG + Intronic
1142654432 17:1381861-1381883 TGGAGTACAGTGGGCCAGTCTGG - Intronic
1143062714 17:4216116-4216138 TGGGGCACAGTGAGCCCTCCTGG + Intronic
1148746437 17:49920868-49920890 AGGGGGACTGGGGGCCAGCCGGG - Intergenic
1149602615 17:57903125-57903147 GTGGGTGCAGTGGGCCAGCCAGG + Intronic
1152701296 17:81821195-81821217 AGGGGTAAATTGAGGCAGGCTGG + Intergenic
1153820206 18:8825760-8825782 AAGGGTACAGTGAGTCAGCCTGG + Exonic
1154085712 18:11303246-11303268 AAGGGGACATTGAGGCAGCCGGG - Intergenic
1154494920 18:14948517-14948539 AGAGGTACAAAGAGCCAGCGAGG + Intergenic
1156539541 18:37895975-37895997 AGAGGTACAGACAGCCAGCCTGG + Intergenic
1157797260 18:50586467-50586489 AGATGTAGAGTCAGCCAGCCTGG + Intronic
1157823115 18:50788307-50788329 AGGGGCACAGTGCCCCAGCCTGG + Intergenic
1157977405 18:52341825-52341847 TGGGGTACAGTGAGCGGTCCTGG + Intronic
1158309287 18:56141196-56141218 AGTGGTTCAGGGACCCAGCCTGG + Intergenic
1159786502 18:72721097-72721119 AGGGGGAAAATCAGCCAGCCAGG - Intergenic
1163547541 19:17948708-17948730 AGGGGTACACTGGGCCAGTGGGG + Intergenic
1163745959 19:19047477-19047499 AGGGAAAAACTGAGCCAGCCAGG + Intronic
1164454873 19:28398626-28398648 AGGGATGCTGTGAGCCAGGCAGG - Intergenic
1165760567 19:38319061-38319083 AAGGGTACAATGATCAAGCCTGG - Intergenic
1165939063 19:39406430-39406452 AGGGGTACAGACAGGCAGACAGG - Intergenic
1166122916 19:40696174-40696196 AGGAGCCCAGTGAGGCAGCCAGG - Intronic
1167637507 19:50663413-50663435 AGGGCAAGAGTGAGCCAGGCAGG - Intronic
1167653892 19:50750697-50750719 GAGGTTGCAGTGAGCCAGCCTGG - Intergenic
926143869 2:10385053-10385075 AAGGTTGCAGTGAGCCAGCCTGG + Intronic
927169046 2:20352780-20352802 AAGGGTAGAGGCAGCCAGCCAGG - Intergenic
929404986 2:41631255-41631277 AGGGGAAGAGTGAGCAGGCCAGG + Intergenic
929651183 2:43681278-43681300 AGAGTTACAGTCAGCCAGCATGG - Intronic
932322025 2:70829383-70829405 AGGAGCAGAGTGAACCAGCCAGG + Intergenic
934579429 2:95426650-95426672 AGTGGGACAGTGAGCAGGCCAGG + Intergenic
934600015 2:95650074-95650096 AGTGGGACAGTGAGCAGGCCAGG - Intergenic
934651005 2:96091404-96091426 AGGGGTCCAGAGACTCAGCCTGG - Intergenic
936533359 2:113292078-113292100 AGTGGGACAGTGAGCAGGCCAGG - Intergenic
937139883 2:119590813-119590835 AGGAGTACAGTGAGGCAGGGAGG - Intronic
939221791 2:139311127-139311149 ATGGGTACAGTGCGCCAGCAGGG + Intergenic
939547280 2:143569075-143569097 ATGGGTGCAGTGAGCCAGCATGG + Intronic
942610236 2:177735837-177735859 AGGGGTCAAGGGAGCCAACCTGG - Intronic
943214374 2:185012233-185012255 AAAGGTTCAGTGAGCCAGCCAGG + Intergenic
943655488 2:190503914-190503936 GGGGGGAAAGTGAGCCAGTCCGG + Intronic
944398308 2:199295643-199295665 AGGGATTCAGTGAGCAAGTCTGG - Intronic
945186431 2:207144514-207144536 AGGGAAACAGTGACCCAGCTGGG - Intronic
946239743 2:218346220-218346242 AGGTGTACCTTGAGTCAGCCAGG + Exonic
946415838 2:219539251-219539273 AGGGGACCAGTGGGCCAGCTTGG + Exonic
948163351 2:235843165-235843187 GGGGGTACAGGGAGCCTGCAGGG - Intronic
948256719 2:236573919-236573941 ATGGGTAGAGTCACCCAGCCTGG - Intronic
948864758 2:240769573-240769595 AGGGGTGCAGCCAGCAAGCCCGG - Intronic
949007020 2:241655552-241655574 AAGGGTCCAATGTGCCAGCCAGG - Intronic
949041385 2:241851469-241851491 AGGGGGACATTGAGCCAGAGAGG - Intronic
1170084449 20:12513354-12513376 GAGGTTGCAGTGAGCCAGCCTGG - Intergenic
1170276402 20:14595346-14595368 AGGGGTTCAGTCTGCCAGGCAGG - Intronic
1170827187 20:19806831-19806853 GAGGCTACAGTGAGCCAGCCTGG + Intergenic
1173021834 20:39273751-39273773 AGGGCTGCAGTGAGTCCGCCTGG + Intergenic
1174300470 20:49578606-49578628 AGGGCTAGAGTGAGAGAGCCTGG + Intergenic
1174632798 20:51972795-51972817 GCGGTTGCAGTGAGCCAGCCTGG + Intergenic
1176869045 21:14072337-14072359 AGGGGGACATTGAGGCAGCCCGG - Intergenic
1178262273 21:31110840-31110862 AGGGGAAGAGTGAGAAAGCCTGG + Intergenic
1178678736 21:34653717-34653739 AGGGGTAGAGTGCTCCAGGCAGG + Intergenic
1178828587 21:36035754-36035776 AGGCGGACTGTGAGGCAGCCAGG - Exonic
1179487874 21:41722460-41722482 AGGGGTTCAGTGTGCAAGTCGGG + Intergenic
1181050600 22:20236636-20236658 GGGGGTCCAGGCAGCCAGCCCGG + Intergenic
1182271863 22:29158869-29158891 AGCTGAGCAGTGAGCCAGCCTGG - Intronic
1183080406 22:35452251-35452273 AGGGGTGGAGTGATCCAGGCAGG - Intergenic
1183249873 22:36722889-36722911 TGGGGGACAGTGTGCCACCCGGG - Intergenic
1184857521 22:47154554-47154576 AGGGCTTCAGGGAGCCAGCCTGG - Intronic
1185093011 22:48786439-48786461 GAGGGGACAGTGAGCCAGGCAGG + Intronic
949266392 3:2161481-2161503 AGAGGTACAAGGAACCAGCCTGG + Intronic
949804564 3:7940271-7940293 ATGGGTGCAGTGAACCAGCATGG + Intergenic
950196877 3:11015570-11015592 AGGGGTGCAGGAAGCCTGCCAGG - Intronic
950464060 3:13142925-13142947 AGGGGAACAGTGTCCCAGGCAGG - Intergenic
951565329 3:24007260-24007282 GAGGCTGCAGTGAGCCAGCCCGG + Intergenic
952596125 3:35019754-35019776 AAGGGTACAGAGAGCTAGCAAGG - Intergenic
953756427 3:45650415-45650437 ATGGGTACAGTAAGCCAACATGG - Intronic
954148038 3:48643953-48643975 GGGGGCAAAGTGAGCCACCCAGG + Intronic
954196966 3:49002689-49002711 AGGGGTGCAGAGAGGCTGCCTGG - Intronic
954708053 3:52491569-52491591 TGGGGCACAGAGAGCCACCCTGG - Intronic
955188401 3:56737028-56737050 GAGGTTGCAGTGAGCCAGCCTGG + Intronic
957825774 3:85440915-85440937 GAGGTTGCAGTGAGCCAGCCTGG + Intronic
958661720 3:97077468-97077490 ATGGGTACAGCGGGCCAGCATGG - Intronic
959887224 3:111516801-111516823 AGATGTACAGCCAGCCAGCCTGG + Intronic
961506095 3:127371447-127371469 GGGGGTACTGGGAGCCAGGCGGG - Intergenic
961552035 3:127674938-127674960 TAGGATACAGTGAGCCTGCCTGG + Intronic
963642448 3:147877058-147877080 TGAAGTTCAGTGAGCCAGCCAGG + Intergenic
964270583 3:154951213-154951235 ATGGGTGCAGTGGGCCAGCCTGG + Intergenic
964466598 3:156999578-156999600 AGGGGGACAGGAGGCCAGCCTGG + Intronic
968008461 3:195258240-195258262 AGGGGGATAGTGTGGCAGCCAGG + Intronic
968443132 4:634472-634494 AGGGGTGCATGGAGCCAGGCTGG + Intronic
968509871 4:990901-990923 AGGGGCACGGGGAGCCAGTCCGG - Intronic
968548632 4:1211171-1211193 AGGGAAGCAGTGTGCCAGCCGGG - Intergenic
969867756 4:10086611-10086633 AGGGCTAGTGTGGGCCAGCCTGG - Intronic
971194275 4:24457035-24457057 AGGGATACAATAAGACAGCCAGG + Intergenic
973155465 4:46946170-46946192 AGGGTTTCAGTGAGACTGCCTGG - Intronic
974974220 4:68870154-68870176 ATGGGTGCAGTGGGCCAGCATGG - Intergenic
978832976 4:113111983-113112005 AGGCCTACTATGAGCCAGCCAGG - Intronic
983265366 4:165502242-165502264 AGGGCTACAGTGAGCCATGATGG - Intergenic
984071293 4:175116472-175116494 AGGGATACAGCTAACCAGCCAGG + Intergenic
984758079 4:183342559-183342581 AGGGGGACAGGGACCCACCCTGG - Intergenic
985575709 5:672545-672567 AGGGGGCCAGTGAGCAAGGCTGG + Intronic
988781618 5:34527723-34527745 GGGGGTACAGTGAGACCACCTGG + Intergenic
989503863 5:42202841-42202863 ATGGGTGCAGTGGGCCAGCATGG - Intergenic
991085937 5:62648413-62648435 AGGGGGCCGGTGGGCCAGCCAGG - Intergenic
992490285 5:77236018-77236040 AAGAGTCCAGTCAGCCAGCCTGG - Intronic
992640008 5:78761112-78761134 AGTGGTCTAGTGAACCAGCCTGG + Intronic
995853799 5:116573348-116573370 GGGCGTACCGTGCGCCAGCCCGG + Intronic
996217490 5:120887243-120887265 TGCAGTTCAGTGAGCCAGCCAGG + Intergenic
997206607 5:132053944-132053966 AGGTGTTCAGTAAGGCAGCCAGG + Intergenic
998015851 5:138731579-138731601 GAGGTTGCAGTGAGCCAGCCTGG + Intronic
999830369 5:155313168-155313190 AGGGGTCCATTCAGCCAGCTGGG + Intergenic
1000384223 5:160658603-160658625 ATGGGTACATTGTACCAGCCAGG + Intronic
1001778279 5:174345419-174345441 AGGGGCACAGAGACCCAGGCAGG - Intergenic
1001959599 5:175872176-175872198 AGGGGTACAGTGCGCACTCCCGG + Intronic
1002821536 6:729847-729869 AGTGTTACCGGGAGCCAGCCAGG - Intergenic
1002900394 6:1405841-1405863 AGGGGTACACAGATCCTGCCAGG - Intergenic
1004237200 6:13884717-13884739 AGGGGTACAGGGAGGCAGGCAGG - Intergenic
1005973212 6:30777693-30777715 AGAGGTACAGAGGGCCAGGCAGG + Intergenic
1006660250 6:35635405-35635427 GAGGCTACAGTGAGCCGGCCCGG + Intronic
1007659265 6:43472961-43472983 GAGGTTGCAGTGAGCCAGCCTGG - Intergenic
1008241240 6:49114762-49114784 AGGTGGAAAGTGAGGCAGCCTGG - Intergenic
1010205945 6:73322760-73322782 AGGGGTGCAGGGGGTCAGCCTGG - Intergenic
1010799737 6:80161608-80161630 AGAGTGACAGTGAGCCAGGCTGG - Intronic
1013584228 6:111564605-111564627 AGGGGTGCAGGAAGTCAGCCAGG + Intronic
1014263010 6:119241342-119241364 AGCCGTTCAGTGAGGCAGCCAGG - Intronic
1015200691 6:130576473-130576495 TGGGGTGCAGGGAGCTAGCCTGG + Intergenic
1016833692 6:148456224-148456246 AGGGGGAAAGTGAGGCAGCAGGG - Intronic
1020443645 7:8245471-8245493 ATGGGTACAGTGGGCCAGCATGG + Intronic
1020663528 7:11010712-11010734 AGGGTGCCAGTGAACCAGCCTGG - Intronic
1021498050 7:21297899-21297921 AAGGTTGCAGTGAGCCAGTCTGG + Intergenic
1022115539 7:27257353-27257375 ATGGCTACAGTTAGCCAGCTGGG - Intergenic
1022191174 7:28018149-28018171 AGGGGTAGAACGAGCCAGCGAGG + Intronic
1023083357 7:36546046-36546068 AGGGTTACAATGAGAAAGCCAGG + Intronic
1023368017 7:39484483-39484505 ATGGGTGCAGTGGGCCAGCATGG - Intronic
1024047143 7:45592603-45592625 AGGGACACAGGGAGTCAGCCGGG - Intronic
1024062440 7:45709223-45709245 AGGGGCAGAGTGAGCCAGCTGGG + Intronic
1025186269 7:56862035-56862057 AGGTGTACTGTGAGCCACCATGG + Intergenic
1025685653 7:63714863-63714885 AGGTGTACTGTGAGCCACCATGG - Intergenic
1025792360 7:64701325-64701347 GGGGTTGCAGTGAGCCAGCCTGG - Intronic
1025907895 7:65802614-65802636 AGGTGTACTGTGAGCCACCATGG - Intergenic
1031783098 7:125994837-125994859 ATGGGTACAGTGGGCCAGCATGG + Intergenic
1032459497 7:132099705-132099727 GAGGTTGCAGTGAGCCAGCCTGG + Intergenic
1033520866 7:142158991-142159013 GGGAGGACAGTGAGCCAGCCAGG - Intronic
1034216061 7:149406645-149406667 AAGGCTGCAGTGAGCCAGCCTGG + Intergenic
1035456141 7:159010178-159010200 TTTGGGACAGTGAGCCAGCCAGG + Intergenic
1035769087 8:2132649-2132671 AGGGCTACAGTGAGCTAGAATGG - Intronic
1035888230 8:3316514-3316536 AGGGGTTCAGTGAGCCTTGCGGG + Intronic
1037752336 8:21690978-21691000 AGGGGTACAGTGAGCCAGCCAGG - Exonic
1037892296 8:22629743-22629765 AGGGGTACCCTGAGCTCGCCTGG + Intronic
1040109941 8:43562787-43562809 AGGGGGACGGTGAGGCAGGCGGG - Intergenic
1040277796 8:46022808-46022830 AAGGGGACATTGAGACAGCCAGG - Intergenic
1040277841 8:46023025-46023047 AAGGGAACATTGAGGCAGCCAGG - Intergenic
1040328577 8:46374622-46374644 AGGGGGACATTGAGGCAGGCAGG - Intergenic
1040649201 8:49430563-49430585 AGGGATACAGCGAGATAGCCAGG + Intergenic
1041093782 8:54329197-54329219 ATGGGTACAGAGAGTCAGCTTGG - Intergenic
1044913061 8:97082357-97082379 AAAGTTACAGTGACCCAGCCTGG + Intronic
1047011624 8:120678973-120678995 AGGGGAACAGTGGCCCAGCTGGG - Intronic
1047911656 8:129536379-129536401 AGAGGTAAAGTGAGCCAACCAGG + Intergenic
1049741272 8:144242156-144242178 AGGAGCACAGGCAGCCAGCCAGG - Intronic
1049878493 8:145044430-145044452 GAGGTTACAGTGAGCCAGCCTGG - Intergenic
1059494696 9:114699916-114699938 AGGGGTGGAGTGGGCCAGACTGG - Intergenic
1060609880 9:124953914-124953936 AAGGCTGCAGTAAGCCAGCCTGG - Intronic
1061663993 9:132149737-132149759 AGGTCTTCACTGAGCCAGCCAGG + Intergenic
1061945512 9:133906476-133906498 AAGGCTGCAGAGAGCCAGCCAGG + Intronic
1062003685 9:134229008-134229030 AGGGGGACAGGGACCCAGCGTGG - Intergenic
1062666421 9:137675674-137675696 GAGGTTGCAGTGAGCCAGCCTGG - Intronic
1187765090 X:22632573-22632595 GAGGTTGCAGTGAGCCAGCCTGG + Intergenic
1189505111 X:41605531-41605553 AAGGCTACAGTGAGCCAGCCTGG + Intronic
1190522652 X:51295968-51295990 TGGGTTACAGTGAGCAAGCCAGG - Intergenic
1190525884 X:51329146-51329168 TGGGTTAAAGTGAGCAAGCCGGG - Intergenic
1190543594 X:51502515-51502537 TGGGTTAAAGTGAGCAAGCCGGG + Intergenic
1190715197 X:53097066-53097088 GGGGTTGCAGTGAGCCAGCCTGG + Intergenic
1191253001 X:58268258-58268280 AGGGAGACACTGAGGCAGCCTGG - Intergenic
1191253511 X:58270219-58270241 AGGGGGACATTTAGGCAGCCTGG - Intergenic
1191253636 X:58270659-58270681 AGGGGGACATTGAGGCAGCCCGG - Intergenic
1191253697 X:58270877-58270899 AGTGGGACACTGAGACAGCCGGG - Intergenic
1191939630 X:66464053-66464075 AGGGGGCCAGTGTGACAGCCTGG + Intergenic
1192613469 X:72591473-72591495 ATGGGTGCAGTGGGCCAGCATGG + Intronic
1193144407 X:78062272-78062294 AGGAGTAAGGTGAGACAGCCTGG + Intergenic
1198445922 X:136714310-136714332 ATGGGTGCAGTGGGCCAGCATGG + Intronic
1199642202 X:149873285-149873307 AGGAATACAGTTAGCCAGGCAGG + Intergenic
1200146747 X:153930316-153930338 AGGGGCATAGTGAGGCAGCAGGG + Intronic
1201498207 Y:14613000-14613022 AGGAGTATAGAGAGCCAGTCTGG + Intronic
1201763454 Y:17560985-17561007 AGGGGGACATTGAGGCAGCCCGG - Intergenic
1201838099 Y:18345005-18345027 AGGGGGACATTGAGGCAGCCCGG + Intergenic