ID: 1037752342

View in Genome Browser
Species Human (GRCh38)
Location 8:21690998-21691020
Sequence CCTTCCATGCAGAGGCTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037752336_1037752342 -3 Left 1037752336 8:21690978-21691000 CCTGGCTGGCTCACTGTACCCCT 0: 1
1: 0
2: 3
3: 32
4: 246
Right 1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG 0: 1
1: 0
2: 4
3: 27
4: 266
1037752330_1037752342 27 Left 1037752330 8:21690948-21690970 CCACGTCTACCCGCAATGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG 0: 1
1: 0
2: 4
3: 27
4: 266
1037752332_1037752342 18 Left 1037752332 8:21690957-21690979 CCCGCAATGGCTGGACAGAGACC 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG 0: 1
1: 0
2: 4
3: 27
4: 266
1037752333_1037752342 17 Left 1037752333 8:21690958-21690980 CCGCAATGGCTGGACAGAGACCT 0: 1
1: 0
2: 2
3: 8
4: 173
Right 1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG 0: 1
1: 0
2: 4
3: 27
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037752342 Original CRISPR CCTTCCATGCAGAGGCTGGA AGG Exonic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG + Intergenic
900594268 1:3473350-3473372 CTGGCCATGCAGAGCCTGGAAGG + Intronic
901568839 1:10142690-10142712 CATTCCCTGCAGAGGCTCTAGGG + Intronic
901660935 1:10797234-10797256 CCTTACATGGAGGGGCTGGGGGG + Intergenic
902110137 1:14071544-14071566 AGTTCCATGCAGAAGCAGGAGGG - Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
905436193 1:37956878-37956900 CATCCCATGCAGAGGCAGGCTGG - Intergenic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
907243081 1:53091374-53091396 CCTTCCAGGCAGAGGCCCGGGGG - Intronic
910654414 1:89605415-89605437 CCTACCATGAAGAGGAGGGACGG + Intergenic
912371887 1:109179964-109179986 GCTGCCATGCAGAGGAGGGAGGG + Intronic
914839523 1:151236715-151236737 CCATCCAGGGAGAGGCTCGACGG + Exonic
917982373 1:180278446-180278468 CCTACCAAGCAGAGTGTGGATGG - Exonic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
919479121 1:198064647-198064669 CTTTCCAGCCAAAGGCTGGAGGG - Intergenic
922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG + Intergenic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
923573519 1:235137800-235137822 CCTTCCAGGAAAAGCCTGGAAGG + Intronic
1062928785 10:1338842-1338864 GCTTCCTTGCATGGGCTGGAGGG + Intronic
1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG + Intergenic
1064067679 10:12196408-12196430 CCTCCCATGCAGTCGCTAGAAGG - Intronic
1065883405 10:30057635-30057657 CCTTTGCTGCAGAGACTGGAAGG - Intronic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067287177 10:44915003-44915025 CCCTCCATGCCCAGCCTGGACGG - Intronic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1069565531 10:69461082-69461104 CCGTTCATGCAGATGCTGGGAGG + Intronic
1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG + Intronic
1072290491 10:93960437-93960459 CCATCCAGGGAGAGGCTCGACGG - Intergenic
1072427194 10:95339444-95339466 CCTTCCCTGCTGAACCTGGAGGG + Intronic
1073116713 10:101095553-101095575 ACTTCCAGGTAAAGGCTGGAAGG - Intronic
1076021569 10:127077889-127077911 CATTCCATGGAGGGGCAGGAGGG + Intronic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1077097823 11:806557-806579 CCTTCCATGTAGGGCCTGGAGGG + Intronic
1078648243 11:13162772-13162794 CTTATAATGCAGAGGCTGGAAGG - Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1084652566 11:70497794-70497816 GCGTCCATGCCGAGGCTGGGAGG + Intronic
1084936921 11:72591805-72591827 CCTGCCATGGTGAGGATGGACGG + Intronic
1085026379 11:73239021-73239043 CCTTCCATGCAGGGCGTTGAGGG + Intergenic
1085643812 11:78209815-78209837 CCTTCGATGTACAGGCTGGTGGG - Exonic
1087983256 11:104644023-104644045 CATTCCATCCAGAGGCTTCAGGG + Intergenic
1088585586 11:111357686-111357708 CCTTCCATGTCCAGGCAGGAAGG + Exonic
1089213823 11:116823536-116823558 CCTTCCATGCTGAGGTTGGTGGG - Intergenic
1089573098 11:119422953-119422975 CTTTCCAGGCAGGGGCGGGAGGG - Intronic
1090405798 11:126475270-126475292 CCATGCAGGCTGAGGCTGGAAGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1092265058 12:6974467-6974489 CCTTCCATACAGAGGCTCAAAGG - Intronic
1096152850 12:49325489-49325511 CTTTCCTTGCAGAGGCTCCAGGG + Exonic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104808883 12:131608031-131608053 CTTTGCATGCAGTGGCTGGTCGG + Intergenic
1105620245 13:22059659-22059681 CATTCCAGGCAGAGGCCTGAGGG + Intergenic
1110367918 13:74708545-74708567 CATTCCCTGCAGAGGCTCTATGG - Intergenic
1110575610 13:77051874-77051896 GCTGCGATGCTGAGGCTGGACGG - Exonic
1112041564 13:95552952-95552974 CCCTCCATGCTGGCGCTGGACGG + Exonic
1112431766 13:99356280-99356302 CATTCCATGCAGGGGCTAAAAGG - Intronic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1115982324 14:39067286-39067308 CTTTCCATGCAGAGGATACATGG - Exonic
1116861878 14:50001789-50001811 CCTTCCACGGAGAGGCTGCCGGG + Intronic
1117771093 14:59135483-59135505 TCTTCCATGCAGAGTTTTGAAGG - Intergenic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1118861991 14:69671562-69671584 AATTCCATGGGGAGGCTGGAGGG + Intronic
1119380955 14:74227788-74227810 GCTTCACTCCAGAGGCTGGATGG + Intergenic
1119663235 14:76466026-76466048 CCTTGCCTGCAGAGCCAGGAGGG - Intronic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122952907 14:105055694-105055716 CCTTCCTTTCAAAGGCGGGATGG + Exonic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1127023971 15:54782048-54782070 CCTCCGTTGCCGAGGCTGGACGG - Intergenic
1128116580 15:65111143-65111165 CCTTCCATACAGAATCAGGAAGG + Intronic
1128625092 15:69193203-69193225 ACCTCCAGGCAGAAGCTGGAGGG + Intronic
1129873736 15:78958597-78958619 GCCTCCCTGCTGAGGCTGGAAGG + Intergenic
1130193715 15:81760067-81760089 TCTTCCATGCAGAAGCGGGTGGG - Intergenic
1130662269 15:85840161-85840183 CCCTCCACGAAGAAGCTGGAAGG + Intergenic
1130986031 15:88845389-88845411 CCTTCCCTGCTGGGGCAGGAGGG - Intronic
1131505298 15:93012812-93012834 CCTTCCATACAAAAGCTGGAAGG - Intronic
1132396623 15:101479579-101479601 CGGTGCATGCAGAGGCTGGTGGG + Intronic
1133343645 16:5055470-5055492 CGTTCAATGCAGAGGAGGGAAGG + Intronic
1133781253 16:8941035-8941057 CTTTCCAATCAGTGGCTGGAAGG - Intronic
1134248237 16:12555796-12555818 CCTTTCTTGCAGAGGCAGGCAGG - Intronic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1137589749 16:49686366-49686388 TCTTCCATGCTGGGGCAGGAGGG + Intronic
1139190000 16:64851799-64851821 CCTAGGATGCAGTGGCTGGAAGG - Intergenic
1139853367 16:69963435-69963457 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139882336 16:70186344-70186366 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1140243430 16:73226007-73226029 ACTTCCATGAAGAGGCTTGGGGG - Intergenic
1140370173 16:74409160-74409182 CCTTCCTAGCAGAGGCTGCTGGG + Intronic
1140827039 16:78716300-78716322 CATTCCCTCCAAAGGCTGGAGGG - Intronic
1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG + Intergenic
1142032253 16:87844436-87844458 CCATCCACCCCGAGGCTGGAGGG + Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144279531 17:13711145-13711167 TCTTTCATGCAGAGGCATGAGGG - Intergenic
1145910657 17:28540284-28540306 CCGCCCCAGCAGAGGCTGGAAGG + Intronic
1146628915 17:34456016-34456038 ACCTCCATGCAGTGGATGGAAGG - Intergenic
1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG + Intergenic
1147659608 17:42110607-42110629 CCTGCCATGGAGAGCCTGGTAGG + Intronic
1148236661 17:45973746-45973768 CCTTCACAGCAGAGGCAGGAGGG - Intronic
1151025502 17:70671834-70671856 CGGTCCATCCAGAGGCTCGAGGG - Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151354182 17:73548773-73548795 CCCACCATGCAGAGCCTGGTTGG - Intronic
1151376917 17:73695496-73695518 CCTGCTATCCAGAGCCTGGAGGG + Intergenic
1151670968 17:75571560-75571582 CCCTCCTGGGAGAGGCTGGAAGG - Intronic
1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG + Intronic
1156676426 18:39531913-39531935 GTTTCCATGCAGAGAATGGACGG + Intergenic
1157493932 18:48142249-48142271 CCTGTCCTGCAGGGGCTGGAAGG + Intronic
1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG + Intronic
1160535368 18:79588769-79588791 CCCTCCGTGCAGGGGCTGGGAGG - Intergenic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1163509844 19:17727893-17727915 TCCACCATGCAGATGCTGGATGG - Exonic
1163559502 19:18010374-18010396 GCTTGCATGCAGAGGGTGGGTGG + Intronic
1163850037 19:19657477-19657499 CCTGCCATGCTCAGGTTGGAGGG - Intronic
1164208964 19:23081176-23081198 ACTTTGTTGCAGAGGCTGGAGGG + Intronic
1165362349 19:35344759-35344781 CCTTCCAGGCAAAGGCTGCCAGG + Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166743132 19:45126182-45126204 CCTTCCCTGCAGAGCCTGTGAGG + Intronic
1167276547 19:48543560-48543582 CCTTCCCTGCAGTGGCTTCAGGG - Intergenic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925255703 2:2485251-2485273 CCTCTCCTGGAGAGGCTGGAGGG + Intergenic
925869897 2:8261041-8261063 CCTTCCATGCAGAGAGTGGTAGG - Intergenic
927006370 2:18853599-18853621 CCTTCTATCCAGAGGTTGAATGG + Intergenic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
929311760 2:40433845-40433867 GCTTCCATGCAGGGTCAGGAGGG + Intronic
929882796 2:45851904-45851926 CCTGCCATGGAGAGGCAGGTGGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931343509 2:61425612-61425634 CCCTCCATGGTGAGGCTGGTGGG - Intronic
932633968 2:73371730-73371752 CCTGCCCTGCAGAGGTTGCAAGG - Intergenic
933040478 2:77458673-77458695 CCTTCCTTGCAGAGGTTCGGTGG + Intronic
935274294 2:101463105-101463127 CCTGTCATACAGAGGCTGCAAGG - Intronic
935731849 2:106070793-106070815 CCTTCCATGGACAGGCTCCAGGG - Intronic
937524425 2:122749645-122749667 CCTTCCATGAAAATGCAGGAAGG + Intergenic
938104411 2:128520348-128520370 CACGCCAAGCAGAGGCTGGAAGG + Intergenic
938138630 2:128779350-128779372 ACATGCATGCGGAGGCTGGATGG - Intergenic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
944692222 2:202168687-202168709 CACTGAATGCAGAGGCTGGAAGG - Intronic
945172154 2:207008051-207008073 CCTTCCTTTCAGAGGATGAAGGG + Intergenic
945442371 2:209895262-209895284 CCTTGCATACAGAGACTGAATGG - Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947721563 2:232372607-232372629 CCTTCCATCCAGAGGCAAGAAGG - Intergenic
948782203 2:240328805-240328827 CCTTCCATTCAGGGGCTGCCGGG - Intergenic
1168765376 20:378666-378688 TCCTCTAGGCAGAGGCTGGATGG - Intronic
1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG + Intergenic
1169482595 20:5998249-5998271 CCTATAATGCAGGGGCTGGAAGG + Intergenic
1169889945 20:10441486-10441508 CATCCCATGCAGTGGCTGGTGGG + Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1172268742 20:33640172-33640194 CCATCCATGCAGGTGCTGGCTGG - Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173655664 20:44698715-44698737 CCTTCCATGTCCAGGCTGGGAGG + Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174619689 20:51864604-51864626 CCTTCCAGGTAGAGCCTGGGTGG - Intergenic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1175228143 20:57457008-57457030 TGTTCCATGCAGAGGCTCCATGG + Intergenic
1175293539 20:57893997-57894019 CTTTCCATTCTGAGGCTGAAGGG + Intergenic
1175816998 20:61888367-61888389 CCTCCCTTGCAGCGGCTGGACGG - Intronic
1175988184 20:62774676-62774698 CCTTCCAGGCAGGGGCTGAGGGG + Intergenic
1176112276 20:63416081-63416103 CCTTCCTTCCAGAAGCCGGAAGG - Intronic
1179568208 21:42262200-42262222 ACTTCCTAGCAGAGGCTGCAAGG + Intronic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1181036155 22:20170648-20170670 GCTTCTCTGCTGAGGCTGGATGG - Intergenic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1181103948 22:20560875-20560897 CATTCTATTAAGAGGCTGGATGG - Intronic
1183191779 22:36326252-36326274 CCTCCCCTTCTGAGGCTGGAAGG - Intronic
1184021944 22:41826808-41826830 CCTCCCAAGCAGAGGAGGGAAGG + Intergenic
1184232997 22:43168591-43168613 CCTGCGGTGCAGAGTCTGGAGGG - Intronic
1184946671 22:47808736-47808758 CCTTGCGGGCAGAGGCTGCACGG + Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1185169747 22:49285892-49285914 CTTTACATCCTGAGGCTGGAAGG + Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950710950 3:14812289-14812311 CTTTCCAAGCAGTGGCTGGCTGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
950980123 3:17294642-17294664 CATTGCATGCAGTGACTGGATGG - Intronic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG + Intergenic
954318385 3:49813609-49813631 CCTGCCATGCAGAGGATTCAGGG - Exonic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955596916 3:60601031-60601053 CCCTGCCAGCAGAGGCTGGAAGG + Intronic
955638162 3:61053106-61053128 CCTTCCCTGCAGTGGATGGGAGG - Intronic
956319170 3:67976373-67976395 AATTTCATGGAGAGGCTGGAAGG - Intergenic
957814889 3:85284653-85284675 CCTCCCATGCATAGGCAGGCAGG - Intronic
958885106 3:99717325-99717347 CCTGCCAAGCATAGGCTGAAAGG - Intronic
961459424 3:127040816-127040838 CCTTCCTTTCAAAGGCTGAATGG - Intergenic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
962355099 3:134686948-134686970 TCCTCCATGCAGAGTCTGAAGGG + Intronic
966819160 3:183911257-183911279 CCTGCCATGAAGAGGCTGTGAGG - Intergenic
968434522 4:577507-577529 CCTCTCAGGAAGAGGCTGGAGGG - Intergenic
968527881 4:1073466-1073488 CCTCCCATGCACCGGGTGGAAGG + Intronic
970779689 4:19721586-19721608 CCTTCACTCCAGAGGCTGGCTGG + Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
975365698 4:73524944-73524966 CCTTCCTAGCAGCGGCTGCATGG - Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
980964757 4:139510267-139510289 ACCTCGATGCAGCGGCTGGAAGG - Exonic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
982059486 4:151590137-151590159 TCTTCCATGCAGAGGCTTAGAGG - Intronic
983275688 4:165614657-165614679 CATTCCATGCAAAGTCTGTAGGG - Intergenic
983971661 4:173882886-173882908 CGTTCCAGGCAGAGACTGTAAGG + Intergenic
985217257 4:187667164-187667186 CCTGCCACTCAGAGGCTGCAAGG + Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
986269494 5:6218488-6218510 CCATGCATCCAGAGGCTGGGAGG - Intergenic
988455229 5:31381634-31381656 CCATCCAGGCAGAGGAGGGATGG - Intergenic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
991295747 5:65078468-65078490 ACTCCCATGGAGAGCCTGGAAGG + Intergenic
992838520 5:80664388-80664410 CCCTCCAGGCAGAAGCTGGGAGG - Intronic
994177531 5:96728069-96728091 ACCTCCATGCAGAGGCAGAATGG - Intronic
994371842 5:98976519-98976541 GCTTCCATGAAGTGGCTTGAGGG - Intergenic
994815375 5:104580021-104580043 GCTTCCATGCAGAGGTTGAGTGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997008704 5:129850732-129850754 TCTTCCATTCAGACTCTGGAAGG - Intergenic
997267371 5:132502681-132502703 GCTGCCATGCTGAGGCTGGTGGG + Intergenic
997962768 5:138335207-138335229 TCTGCCCTGCAGAGGCTGGCTGG - Intronic
998504365 5:142660276-142660298 CCTTCCAGTCAGAGGCTGAGTGG - Intronic
999181841 5:149675371-149675393 CCTTCCTTGGAGAGGCTGATAGG - Intergenic
999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG + Intergenic
999763587 5:154721583-154721605 GCTTCCCTGCAGTGGCTGGCAGG - Intronic
1001727518 5:173918590-173918612 GTTTCCATTCAGAGGCTAGAGGG - Intronic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1002059667 5:176619120-176619142 TCTTCCAGCTAGAGGCTGGAGGG + Intergenic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1002764384 6:226713-226735 CCTTCCATGAAAAGTCTGCATGG - Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004789792 6:19012099-19012121 CCTTCATTGCAAAGGCTGAAGGG + Intergenic
1005105349 6:22218669-22218691 CCTTCCTTCCAGAGGCTCTAGGG - Intergenic
1007074280 6:39056908-39056930 CAGTCCATGCACAGGCTGGGAGG - Intronic
1007109112 6:39302883-39302905 CCTTGCAAACAGAGGCTAGAAGG + Intronic
1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG + Intergenic
1018250294 6:161862734-161862756 CCTTCCATTCAGAGGCGAGAAGG + Intronic
1019064793 6:169288003-169288025 CCTTCCATGGAGTCTCTGGAGGG - Intergenic
1022206155 7:28165618-28165640 TGTTCCAGGCAGAGGCTGCAAGG - Intronic
1022508868 7:30922778-30922800 CCTGCCATGTAGAGGCAGGCTGG + Intronic
1023344462 7:39257066-39257088 CCTTCCATTGAGAGGGTTGACGG - Intronic
1023859427 7:44208572-44208594 CCTTCAATGCAAACGCTGCAAGG - Intronic
1027730912 7:81871427-81871449 CTTACCATCCAGATGCTGGATGG - Intergenic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1030006593 7:105126467-105126489 ACATCCATGCAGAGGCTTGTGGG + Intronic
1034499091 7:151438722-151438744 CCTTCACTGGAGAGGCTGAATGG + Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG + Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037419434 8:18686759-18686781 CCTTCCATGCATGGGCTGAGTGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039659142 8:39444572-39444594 CCTTCCTTGCTGAGCATGGAAGG - Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1040657058 8:49522677-49522699 CCTTCCATCCAGAGGCACGAAGG - Intergenic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1045381531 8:101632218-101632240 ACTTCCCATCAGAGGCTGGATGG - Exonic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1047104750 8:121720250-121720272 CCTCCCATCCAGAGGCTCGGGGG - Intergenic
1047207705 8:122816994-122817016 CTCTCCATGCAGATGGTGGATGG + Intronic
1047628285 8:126678819-126678841 GCTGGCAAGCAGAGGCTGGACGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049477914 8:142805436-142805458 CCTTCCGTATAGGGGCTGGAGGG + Intergenic
1049591951 8:143466691-143466713 GGCTCCATGCTGAGGCTGGACGG - Intronic
1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG + Intronic
1050855816 9:10353512-10353534 TCTCCCATGCAGAGGTTGGCAGG - Intronic
1051122074 9:13762198-13762220 CTTGCCATGGAGAGGCTGGTCGG + Intergenic
1051966761 9:22837005-22837027 CATGCCATGCAGTGGCTGGTGGG + Intergenic
1053242122 9:36504589-36504611 CCCTCCCTGCAGAGGCTGTTGGG + Intergenic
1056148453 9:83759292-83759314 GCTTCAATGCCCAGGCTGGAAGG + Intronic
1057230758 9:93320014-93320036 CCCTCCATGCAGAAGCTCGAAGG - Intronic
1059427490 9:114230333-114230355 CCTTCCTTGCAGAGGAAGGAAGG + Intronic
1059432459 9:114258388-114258410 CCTTCCATGTGGAGGCTGCTGGG + Intronic
1060273913 9:122167811-122167833 CATTCCATCCAGAGGCTCTACGG + Intronic
1061234421 9:129334332-129334354 CCTTCCAGGCAGAGCCTTCAGGG - Intergenic
1061678691 9:132232047-132232069 CCTTCCAAGCAATGGCTTGAAGG - Intronic
1061839032 9:133347186-133347208 CCTGCCGCGCAGAGACTGGAGGG - Exonic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1187272685 X:17793017-17793039 CCTTCCCTGGACAGCCTGGAGGG + Intergenic
1187478778 X:19635771-19635793 ACTTCCATGCAGGGACAGGAGGG - Intronic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1192212600 X:69137283-69137305 CCTTTCATGCGGGGGCTGAATGG - Intergenic
1195587767 X:106585534-106585556 CCTGCCATCAAGATGCTGGATGG + Intergenic
1196153782 X:112405079-112405101 CTTTCCATGCTGAGGCAGCATGG - Intergenic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1199692340 X:150318144-150318166 GCTTCCAAGCAGAGGCATGATGG - Intergenic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1202231445 Y:22663259-22663281 GCTTCCATGGAGAAGCTGAAAGG - Intergenic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202311713 Y:23532906-23532928 GCTTCCATGGAGAAGCTGAAAGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1202559089 Y:26137688-26137710 GCTTCCATGGAGAAGCTGAAAGG - Intergenic