ID: 1037753066

View in Genome Browser
Species Human (GRCh38)
Location 8:21695257-21695279
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037753055_1037753066 29 Left 1037753055 8:21695205-21695227 CCTGGTGTGGCCACCTGGATGCA 0: 1
1: 0
2: 0
3: 18
4: 193
Right 1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG No data
1037753058_1037753066 19 Left 1037753058 8:21695215-21695237 CCACCTGGATGCAGGGCCAGAGG 0: 1
1: 0
2: 2
3: 36
4: 303
Right 1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG No data
1037753054_1037753066 30 Left 1037753054 8:21695204-21695226 CCCTGGTGTGGCCACCTGGATGC 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG No data
1037753061_1037753066 16 Left 1037753061 8:21695218-21695240 CCTGGATGCAGGGCCAGAGGGCG 0: 1
1: 0
2: 0
3: 24
4: 249
Right 1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG No data
1037753062_1037753066 3 Left 1037753062 8:21695231-21695253 CCAGAGGGCGCACATGATGAACG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr