ID: 1037753822

View in Genome Browser
Species Human (GRCh38)
Location 8:21698978-21699000
Sequence AACGCACTCTCTCCCTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037753811_1037753822 29 Left 1037753811 8:21698926-21698948 CCTAGCAGCAGGCACTGTTATGC 0: 1
1: 0
2: 2
3: 18
4: 202
Right 1037753822 8:21698978-21699000 AACGCACTCTCTCCCTCTTCTGG No data
1037753817_1037753822 -2 Left 1037753817 8:21698957-21698979 CCTTGGCCTCCACTCCCAGTCAA 0: 1
1: 0
2: 1
3: 32
4: 316
Right 1037753822 8:21698978-21699000 AACGCACTCTCTCCCTCTTCTGG No data
1037753816_1037753822 6 Left 1037753816 8:21698949-21698971 CCACGGGTCCTTGGCCTCCACTC 0: 1
1: 0
2: 2
3: 15
4: 181
Right 1037753822 8:21698978-21699000 AACGCACTCTCTCCCTCTTCTGG No data
1037753818_1037753822 -8 Left 1037753818 8:21698963-21698985 CCTCCACTCCCAGTCAACGCACT 0: 1
1: 0
2: 0
3: 23
4: 305
Right 1037753822 8:21698978-21699000 AACGCACTCTCTCCCTCTTCTGG No data
1037753815_1037753822 7 Left 1037753815 8:21698948-21698970 CCCACGGGTCCTTGGCCTCCACT 0: 1
1: 1
2: 1
3: 8
4: 103
Right 1037753822 8:21698978-21699000 AACGCACTCTCTCCCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037753822 Original CRISPR AACGCACTCTCTCCCTCTTC TGG Intronic
No off target data available for this crispr