ID: 1037754081

View in Genome Browser
Species Human (GRCh38)
Location 8:21700312-21700334
Sequence CCTGCCTCCCTGGGGCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 852
Summary {0: 1, 1: 0, 2: 22, 3: 132, 4: 697}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037754081_1037754089 -7 Left 1037754081 8:21700312-21700334 CCACAGAGCCCCAGGGAGGCAGG 0: 1
1: 0
2: 22
3: 132
4: 697
Right 1037754089 8:21700328-21700350 AGGCAGGGCTGCCCAGAGAGGGG No data
1037754081_1037754088 -8 Left 1037754081 8:21700312-21700334 CCACAGAGCCCCAGGGAGGCAGG 0: 1
1: 0
2: 22
3: 132
4: 697
Right 1037754088 8:21700327-21700349 GAGGCAGGGCTGCCCAGAGAGGG No data
1037754081_1037754093 8 Left 1037754081 8:21700312-21700334 CCACAGAGCCCCAGGGAGGCAGG 0: 1
1: 0
2: 22
3: 132
4: 697
Right 1037754093 8:21700343-21700365 GAGAGGGGGCCAAAGCCTGAAGG No data
1037754081_1037754087 -9 Left 1037754081 8:21700312-21700334 CCACAGAGCCCCAGGGAGGCAGG 0: 1
1: 0
2: 22
3: 132
4: 697
Right 1037754087 8:21700326-21700348 GGAGGCAGGGCTGCCCAGAGAGG No data
1037754081_1037754096 27 Left 1037754081 8:21700312-21700334 CCACAGAGCCCCAGGGAGGCAGG 0: 1
1: 0
2: 22
3: 132
4: 697
Right 1037754096 8:21700362-21700384 AAGGAGACACTTCTGAGAGTAGG No data
1037754081_1037754090 -6 Left 1037754081 8:21700312-21700334 CCACAGAGCCCCAGGGAGGCAGG 0: 1
1: 0
2: 22
3: 132
4: 697
Right 1037754090 8:21700329-21700351 GGCAGGGCTGCCCAGAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037754081 Original CRISPR CCTGCCTCCCTGGGGCTCTG TGG (reversed) Intronic
900080891 1:856556-856578 GCTTCCTCCCTGGGGCTCAGTGG + Intergenic
900321210 1:2085096-2085118 CTGCCCTCCCTGTGGCTCTGCGG + Intronic
900408947 1:2504264-2504286 CCACCCTCCCAGGGGCTCCGTGG - Exonic
900495048 1:2972457-2972479 CCTGGGACCCTGGGGCTTTGCGG - Intergenic
900533901 1:3167833-3167855 CCTGCCTCCCAGCGCCTCTGTGG + Intronic
900533921 1:3167891-3167913 CCTGCCTCCCAGCGCCTCTGTGG + Intronic
900533961 1:3168009-3168031 CCTGCCTCCCAGCGCCTCTGTGG + Intronic
900534001 1:3168127-3168149 CCTGCCTCCCAGTGCCTCTGTGG + Intronic
900534021 1:3168185-3168207 CCTGCCTCCCAGTGCCTCTGTGG + Intronic
900534041 1:3168243-3168265 CCTGCCTCCCAGCGCCTCTGTGG + Intronic
900534061 1:3168301-3168323 CCTGCCTCCCAGTGCCTCTGTGG + Intronic
900553120 1:3266438-3266460 CCAGTCTCTCTGGGGCTCTCAGG - Intronic
900589200 1:3452259-3452281 CCTCCCTCCCTGGGGCCCTAAGG - Intergenic
900640257 1:3685039-3685061 CCTCCCTCCCTGGGGTCCAGCGG - Intronic
900900019 1:5509854-5509876 CCTGCCGGCCTGGGGCTCCCTGG + Intergenic
900921091 1:5671134-5671156 CCTGCCACAGTGTGGCTCTGGGG - Intergenic
901008097 1:6181238-6181260 ACTGCCTCGCAGGGGCACTGGGG + Intergenic
901248764 1:7756207-7756229 TCTCCCTCCCTGGTGCTGTGAGG + Intronic
901480334 1:9520644-9520666 ACAGTCTCCCTGGGGCCCTGTGG + Intergenic
901793758 1:11668589-11668611 CCTGGTTCCCTGGGGACCTGAGG + Intronic
902254160 1:15176741-15176763 ACAGCCTCCCTGGGGAGCTGGGG + Intronic
902365365 1:15969584-15969606 GCTGCCTGCCTGGGCCTCGGAGG + Intronic
902644681 1:17790206-17790228 ACTCCCTCACTGGGGCCCTGTGG - Intronic
902685881 1:18077440-18077462 GCTGCCTCCCTGGGGCTGGCTGG - Intergenic
902706378 1:18208153-18208175 CCTTCCTCCCAGGGGCCCTCAGG - Intronic
902715750 1:18271623-18271645 CCTGCCTCCCTGGGGTGCCTAGG - Intronic
902940071 1:19794544-19794566 CCCGTCACTCTGGGGCTCTGGGG - Intronic
903273846 1:22208593-22208615 CCTGCCTCTCTGGGGCCTTCAGG - Intergenic
903340205 1:22649153-22649175 CATGACTCCGTGGGGCTTTGTGG - Intergenic
903357749 1:22758507-22758529 ACTGCCTCCCTGGGGCTCCCAGG + Intronic
903535363 1:24063089-24063111 CCAGCCTGGCTGGGGTTCTGGGG + Intronic
903815373 1:26060770-26060792 CCTGGGTCCCTGGGCCTGTGAGG - Intronic
904029669 1:27526266-27526288 ACTGCCTGCCTTGGGCACTGTGG + Intergenic
904276958 1:29391068-29391090 CCTGCCTTGTTGGGGCTGTGGGG + Intergenic
904457840 1:30658010-30658032 CCAGCCTCCGTGGGGGCCTGGGG - Intergenic
904473295 1:30748802-30748824 CCTCCCTCCACTGGGCTCTGGGG + Intronic
904946922 1:34206186-34206208 CCTTCCTCCCTGGTGCTCCCAGG + Intronic
905106398 1:35565851-35565873 CCTGCCCCCATGGGGGCCTGAGG - Exonic
905170657 1:36107835-36107857 CGGGCCTCCCTGGGGCTCTCTGG + Intronic
905206195 1:36344091-36344113 CCTGCCTCCCGGGGGGTGGGGGG - Intronic
905257497 1:36694395-36694417 CTTGCCTCCATCTGGCTCTGCGG + Intergenic
905308998 1:37036747-37036769 GCTGCTTCCCTGGGGCGCCGAGG - Intergenic
905766574 1:40606768-40606790 CCTGCCTCTCTGCTGCTATGTGG - Intergenic
906142487 1:43542090-43542112 CCTGGGACCCTGGGACTCTGGGG + Intronic
906484284 1:46222283-46222305 GCTGCCAACCTGGGGCTCAGAGG + Intergenic
906593265 1:47048131-47048153 CCTGCCTACTTGGGGGACTGAGG + Intronic
906854642 1:49291802-49291824 CCTGGCTCCCTCTGGCTCTGTGG - Intronic
906952925 1:50349243-50349265 CCTGCCTCCCGGGAGCCCTTTGG + Intergenic
907273772 1:53305777-53305799 CCTGGCTCCCTGTGGGGCTGAGG - Intronic
907316746 1:53577212-53577234 CCTACCCCCCTGGGGCCCTCTGG + Intronic
907393079 1:54171344-54171366 CCTGTCTCCCTGTGGCCTTGGGG - Intronic
907444533 1:54499422-54499444 CCTGCCTCCCTCTTGCCCTGCGG - Intergenic
907486922 1:54784450-54784472 CCTGCCTCCCTGGTTCTATGTGG + Intronic
907830876 1:58063076-58063098 CCTCACTACCTGGGGCTCTCTGG + Intronic
907966629 1:59337237-59337259 GCAGCCTGCCTGGGGCTCTCAGG - Intronic
910259966 1:85284932-85284954 ACACCCTCTCTGGGGCTCTGTGG + Intergenic
910741107 1:90517462-90517484 GCAGCATCCCAGGGGCTCTGGGG + Intergenic
911025993 1:93435613-93435635 CCTGGATCCCTCTGGCTCTGTGG + Intergenic
911094313 1:94043264-94043286 CCTGCCTCCTGGGTGCACTGGGG + Intronic
911715538 1:101128364-101128386 CTTTCCTCCCTGAGTCTCTGAGG + Intergenic
912267229 1:108170904-108170926 CCTGTTTCCCTGGGGGTTTGAGG - Intronic
912382988 1:109257647-109257669 ACTGACTCAGTGGGGCTCTGGGG + Intronic
912391686 1:109307250-109307272 TCTCCCTCCCTGGTGCTGTGGGG - Intergenic
912410985 1:109480584-109480606 CCATCCATCCTGGGGCTCTGGGG - Exonic
912459118 1:109819464-109819486 CCATCTTCCCTGTGGCTCTGTGG + Intergenic
912491123 1:110063380-110063402 CCTGCCTCCCTGCTCCTCCGAGG - Intronic
912690743 1:111802987-111803009 CCTGACTCCCTGAGGCTGTGTGG + Intronic
912695023 1:111834996-111835018 CCTGGATCCCTGGGGCTTGGAGG + Intronic
913225767 1:116696806-116696828 CCTGCCTCACAGAGGCCCTGAGG - Intronic
914916581 1:151822805-151822827 GCCCCTTCCCTGGGGCTCTGAGG - Intronic
915556405 1:156663312-156663334 CCACCCTTCCTGGGGCTCTGGGG + Intergenic
915828876 1:159106271-159106293 CCTGGCTCCCACAGGCTCTGTGG + Intronic
915872522 1:159576243-159576265 CCTACCTCACTGGGTTTCTGTGG - Intergenic
915904956 1:159870988-159871010 CCTTCCTCCCTAGGGGTCTTGGG - Intronic
916219666 1:162431385-162431407 CCTGCTCCCCTGGGGCTCAGTGG - Intergenic
916526829 1:165618185-165618207 CCTGCTTCCCTGTGGGTATGGGG + Intergenic
917792299 1:178506752-178506774 CCTCCCTACATGGGACTCTGAGG - Intergenic
917973710 1:180225237-180225259 CCTGCTCTCCCGGGGCTCTGTGG - Intergenic
917977957 1:180252124-180252146 GCTGGCCACCTGGGGCTCTGGGG + Intronic
918186022 1:182128572-182128594 CCTGCCTCCCTGGGTGGCTATGG + Intergenic
918321688 1:183370892-183370914 CAACCCTCCCTGAGGCTCTGGGG - Intronic
922740122 1:228009822-228009844 CCTGCCTCCCCAGGGCTGGGTGG + Intronic
922770027 1:228176668-228176690 CCTGCCTGCTTGGCCCTCTGTGG - Exonic
923526339 1:234775658-234775680 CCTACTTCCCTGGGGCCCCGAGG - Intergenic
1063173661 10:3532787-3532809 CCGTCCTCCCCAGGGCTCTGTGG + Intergenic
1063217534 10:3938040-3938062 CCTGGGTCCCTGTGGCCCTGGGG - Intergenic
1063371521 10:5525617-5525639 CCTGCCTCCCCTGGGCACTGTGG + Exonic
1064193311 10:13225939-13225961 CCTGCCTTGATGGAGCTCTGGGG + Intronic
1064748191 10:18498688-18498710 CAGCGCTCCCTGGGGCTCTGTGG + Intronic
1065588382 10:27241523-27241545 CCTGGCTCCCTGGGGCTGGGTGG - Intronic
1065591375 10:27265638-27265660 CCTGGCTGCCTGGGGGGCTGAGG - Intergenic
1065760087 10:28974045-28974067 CCTGCCTACCTTGGCCCCTGGGG + Intergenic
1066055187 10:31674150-31674172 CCCTCTTCCCTGAGGCTCTGAGG - Intergenic
1066439411 10:35424034-35424056 CCACACTGCCTGGGGCTCTGGGG + Intronic
1066544251 10:36482252-36482274 CCTGCCAGCCTGGGGCAATGAGG - Intergenic
1067229043 10:44394309-44394331 CCAGCCAGCCTGGGCCTCTGAGG - Intergenic
1067546543 10:47196311-47196333 CCTGTCGCCATGGAGCTCTGAGG + Intergenic
1067691322 10:48504103-48504125 CCTGCTGCCCTGGGGGCCTGGGG + Intronic
1068721994 10:60255883-60255905 CCTTCCTCACTGGGGCCCAGAGG + Intronic
1069334205 10:67328616-67328638 CCTGGCCCCCAGTGGCTCTGAGG - Intronic
1069659213 10:70112595-70112617 CCAGCCTCTCTGGGGTTCTCAGG - Exonic
1069829149 10:71271992-71272014 CCTGGCTCCTTGCGGCTGTGGGG - Intronic
1069859169 10:71459802-71459824 GCTGCCTCCAGGGAGCTCTGGGG - Intronic
1069886539 10:71627456-71627478 CCAGCCTCCCTGGGGACCAGAGG + Intronic
1070162454 10:73874342-73874364 CCTGCCGCCCGGGAGCTATGCGG - Intronic
1070664881 10:78336017-78336039 CCTGGTGCCCTGGAGCTCTGGGG + Intergenic
1070744881 10:78927645-78927667 TCTCCCTTCCTGGGGCTGTGTGG - Intergenic
1070778863 10:79126159-79126181 CCGGCCTCACTGGGGCTCTCTGG - Intronic
1070988297 10:80707652-80707674 GCTGAGTCCCTGGGGCTGTGAGG + Intergenic
1071511984 10:86267785-86267807 CCTGTGTCTCTGGAGCTCTGGGG - Intronic
1071564044 10:86662480-86662502 CAGGCAGCCCTGGGGCTCTGGGG + Intronic
1071856991 10:89635974-89635996 CCTGCCTACCTGAGGCCTTGGGG - Intronic
1072434902 10:95405934-95405956 CCTGCCTCCCTGGAGCTTGCAGG - Intronic
1073118482 10:101107040-101107062 CCTGCCTCCCAGTTGCTGTGGGG - Intronic
1073307973 10:102518032-102518054 CCTGTCTCCCTGTGACTTTGAGG + Intronic
1073428898 10:103473283-103473305 GCTGCATCCCCCGGGCTCTGCGG - Exonic
1074970176 10:118529691-118529713 CATGCATCCCTCGGCCTCTGTGG - Intergenic
1075039349 10:119095509-119095531 CCTGGCTACCTGGGGGACTGAGG - Intergenic
1075331990 10:121580614-121580636 CCTGCCTTCCTTGGGTCCTGCGG - Intronic
1075664864 10:124222915-124222937 CCTGGCTGCCTGGGGCTTGGGGG - Intergenic
1076366234 10:129922492-129922514 CCTGCCCTCCAGGGGCTATGGGG - Intronic
1076405132 10:130206632-130206654 CCTGCCTGCCTTGTGCTGTGTGG + Intergenic
1076477508 10:130762735-130762757 CCTGCTTCCCTGGGGCTCTTGGG + Intergenic
1076560381 10:131359196-131359218 CCTTCCTAAGTGGGGCTCTGAGG - Intergenic
1076655349 10:132019926-132019948 CCTGGCTCCCGCCGGCTCTGTGG + Intergenic
1076700760 10:132271463-132271485 CCTGCCTCACTGGGCACCTGAGG + Intronic
1076706241 10:132303127-132303149 GCAGCCTGCCTGGGGCTCTGCGG + Intronic
1076741582 10:132488352-132488374 CCTGCTGCCCTGAGGCTCTGCGG + Intergenic
1076759497 10:132594783-132594805 GCTGCCTGCCTGGAGCTCTCTGG + Intronic
1076774704 10:132688260-132688282 CCTGCCGCCCTGCGCCTCTGAGG + Intronic
1076819908 10:132933125-132933147 CCTGCATCCCTGGGTAGCTGTGG + Intronic
1076879326 10:133232084-133232106 GCATCCTCCCTGGAGCTCTGTGG - Intergenic
1076881462 10:133241540-133241562 CCTGCCTCCTGGGCACTCTGGGG - Exonic
1076887950 10:133271152-133271174 CCTGCCAGCCATGGGCTCTGGGG + Intronic
1077177804 11:1198511-1198533 CCTGGCTCCGGGGGGCTCCGGGG + Intronic
1077264693 11:1642829-1642851 CCTCCCTCCCAGGGGAGCTGAGG + Intergenic
1077329850 11:1979437-1979459 GCTGCAGCCCAGGGGCTCTGTGG + Intronic
1077340590 11:2024683-2024705 CCTTCCTCCAAGGTGCTCTGGGG + Intergenic
1077366139 11:2162112-2162134 TCTGCCACCCTGGGGAGCTGAGG - Intergenic
1077371105 11:2182024-2182046 CCTGTGTCCCTGGGGCCCTGGGG + Intergenic
1078453076 11:11454694-11454716 CCTGACTCTCTGGCTCTCTGTGG - Intronic
1078652567 11:13209257-13209279 TCTGACTCCCTGGGGCACTGTGG + Intergenic
1078920761 11:15828075-15828097 CCTGCTTCTCTGTGGCTGTGTGG - Intergenic
1079003360 11:16775632-16775654 CCTGCCTGCCTTGGTGTCTGTGG - Intergenic
1079327685 11:19508318-19508340 CCTTCCTCCCCAGGGCTCTATGG + Intronic
1080432323 11:32210414-32210436 CCAGCCTTCCTGGAGATCTGGGG - Intergenic
1080588121 11:33699682-33699704 GCAGCCCCCCTGGGACTCTGTGG - Intronic
1080966914 11:37224211-37224233 ACACCCTCCTTGGGGCTCTGTGG - Intergenic
1081635321 11:44717682-44717704 CTTCCATCTCTGGGGCTCTGTGG + Intergenic
1081674455 11:44960427-44960449 CCTGCCTCCCCAGGGGTCCGGGG + Intergenic
1081710197 11:45211269-45211291 CATGCCTCCCAGGGGTCCTGGGG - Intronic
1081775679 11:45674658-45674680 CCTGCCTCCCTCGCTCCCTGGGG + Intergenic
1083184797 11:61011271-61011293 CTTGCCTCCCCGGGGCTCTCTGG + Intronic
1083476976 11:62921256-62921278 ACTGCCTCCCTGGGGGCCTGCGG + Exonic
1083571734 11:63764945-63764967 CCTGGCTCCCTGGGGCTCAGCGG - Exonic
1083596259 11:63919426-63919448 CCTGCCGCCCCGGGGCTGCGGGG + Intergenic
1083601606 11:63952149-63952171 CCTTCCTCCCTGTGATTCTGAGG + Intronic
1083619151 11:64040446-64040468 GCTGTCTCCCTGGGTCTCTGTGG + Intronic
1083960626 11:66012983-66013005 CCTGAGTGCCTGAGGCTCTGGGG - Intronic
1084116190 11:67044439-67044461 CCTGCCTGCCTGGAGCCCTGTGG + Intronic
1084430118 11:69106383-69106405 CCTGCTGCCGAGGGGCTCTGTGG + Intergenic
1084700683 11:70784703-70784725 TCTGCCTCCCTGGGAGCCTGTGG + Intronic
1084823481 11:71711254-71711276 TCTACCTACCTGGAGCTCTGGGG - Intergenic
1084900163 11:72303575-72303597 CCTGCCTCACCAGGGGTCTGAGG + Intronic
1085039206 11:73317176-73317198 CCTGCCTCACTGGGACCCTGTGG - Intronic
1085050228 11:73376580-73376602 CCTGCCTCCCCGTGTCTCTGAGG + Intronic
1085068639 11:73521431-73521453 CCTTCCACCCTTGGGCTCAGTGG - Intronic
1085284500 11:75351299-75351321 CCTGCCCCCGTGCGTCTCTGCGG + Intronic
1085704196 11:78771256-78771278 CCTACCTCCCTGGGCTGCTGTGG - Intronic
1086821908 11:91445695-91445717 CATCCCTCCCTGGGGCTCTCAGG + Intergenic
1087252866 11:95923706-95923728 CCTCCCTCCCTGGGGCGTGGAGG - Intronic
1088692413 11:112338997-112339019 CCTGAGTCCCTGCGGCTGTGTGG + Intergenic
1088971502 11:114778655-114778677 CCTCCCTCCCAGCTGCTCTGGGG - Intergenic
1089331028 11:117689013-117689035 GCTGCTTCCCTGGAGCTATGAGG - Intronic
1089557291 11:119321406-119321428 TCTGTCTCCCTGCAGCTCTGCGG + Intronic
1089741840 11:120589930-120589952 CCTCCCTCCCTGGGCCTCAGGGG - Intronic
1090125092 11:124076222-124076244 CCTGGCTCCCAGCGGCTCCGTGG + Intergenic
1090513412 11:127399265-127399287 CCAGCCTGCCAGAGGCTCTGGGG - Intergenic
1090514535 11:127411568-127411590 CCTCCCTCCTTGGGGCCCTGTGG - Intergenic
1090915648 11:131160120-131160142 GGTGCCTCTCTGTGGCTCTGTGG + Intergenic
1091142900 11:133251323-133251345 CCTGCCTGCTTGGGGCACTAAGG - Intronic
1091281590 11:134384624-134384646 GCTGCGGCCCTGGGGCTTTGTGG - Intronic
1202812828 11_KI270721v1_random:34616-34638 GCTGCAGCCCAGGGGCTCTGTGG + Intergenic
1202823575 11_KI270721v1_random:79872-79894 CCTTCCTCCAAGGTGCTCTGGGG + Intergenic
1091587575 12:1824944-1824966 CCTGCCTCCCTGGGTCCCTTGGG - Intronic
1091797239 12:3304341-3304363 CCTGCATGTCTGGGGCTCTGAGG - Intergenic
1091805736 12:3354730-3354752 CCTGGCTTCCTGGGGGACTGTGG - Intergenic
1092247317 12:6871024-6871046 CCTCCCTCCAAGTGGCTCTGGGG + Exonic
1092950510 12:13499102-13499124 CCTGCTTCCCTGAGGCTTCGGGG + Intergenic
1093426126 12:19031344-19031366 CCTACTTCCCTGGGGCCATGAGG + Intergenic
1093582052 12:20794222-20794244 CCCGCCTTCCTAGGGCTCTCTGG + Intergenic
1094854142 12:34395436-34395458 CTTGGGTCCCAGGGGCTCTGTGG - Intergenic
1095957243 12:47813765-47813787 CCTTCCACCCTGGGCCTCTCTGG - Intronic
1096498982 12:52054226-52054248 CCTGCCACCTTGCTGCTCTGGGG + Intronic
1096543581 12:52322132-52322154 CATGAGTCCCTGGAGCTCTGAGG - Intergenic
1096553768 12:52390910-52390932 CCAGCCTCCCTAGGCCTCTCTGG + Intergenic
1096735363 12:53649182-53649204 GCGGCCTCCCGGGGGCTCTCGGG - Intronic
1096790213 12:54039742-54039764 CCAGCCTCCCCAGGGCTCTAGGG + Intronic
1097085959 12:56468659-56468681 CCTACCTCTCTGGGCCTCTGTGG - Exonic
1097661536 12:62436023-62436045 GCTGCCTGTCTGGGGCTGTGAGG + Intergenic
1097872216 12:64610812-64610834 CCTGCCTCCACGTGTCTCTGCGG + Intronic
1099557454 12:84128322-84128344 CCTGGCTCCAGGTGGCTCTGTGG - Intergenic
1099682155 12:85843650-85843672 CCTGGCTCCCGCTGGCTCTGTGG - Intergenic
1100134853 12:91543361-91543383 CTTGGCTTCCTGTGGCTCTGGGG - Intergenic
1100407920 12:94287092-94287114 CCTGCCTCCCAGGGTTTTTGTGG - Intronic
1101639549 12:106578006-106578028 CCTGGCTTCCAGTGGCTCTGGGG + Intronic
1101641381 12:106587520-106587542 CCTGCTTCCCAGAGGCTCCGAGG + Intronic
1102111946 12:110371557-110371579 CAGGCCTCCCTGGGGAGCTGGGG - Intergenic
1102236851 12:111298984-111299006 CCTGCCTTCCTCCGGCTCAGAGG + Intronic
1102536796 12:113587850-113587872 CCTTTCTCGCTGGGGCTCAGCGG - Intergenic
1102684005 12:114710213-114710235 CCTGCCTCCCGTGAGCTCTGAGG - Intergenic
1102741781 12:115213849-115213871 CCTGCCAACGTGGGGCTGTGGGG + Intergenic
1103851409 12:123936041-123936063 CCAGCCTGCCTGGGTCTGTGTGG + Exonic
1103894808 12:124265811-124265833 CCTGCCTCCTTGGGCCACTGTGG - Intronic
1104001486 12:124863449-124863471 CTGGCCTCCCTCGTGCTCTGCGG + Intronic
1104806245 12:131591329-131591351 CCTGCACACCTGGGGCTCAGAGG + Intergenic
1104877509 12:132046000-132046022 CCTTCATCCCTGTGGGTCTGCGG + Intronic
1104944279 12:132408777-132408799 CCTGCTCCCCTGGGGCCGTGTGG - Intergenic
1105353091 13:19633545-19633567 CCTGCGTCCCGCGGGCTCAGCGG + Intergenic
1106110715 13:26774184-26774206 CCTGCCCTCCTGGGGCTCTTGGG + Intergenic
1106243545 13:27928283-27928305 GCTGCCTCCCTGGGCCTCCCTGG - Intergenic
1106253430 13:28001392-28001414 ACAGCCTCTTTGGGGCTCTGTGG - Intergenic
1106362995 13:29049776-29049798 GCTGCCTCCCTGCTGCTCTGTGG - Intronic
1106413094 13:29524597-29524619 CCTTCCTCCGAGGGGCCCTGGGG - Intronic
1106557427 13:30822125-30822147 CATGCCAGCCTGGGCCTCTGGGG - Intergenic
1107229187 13:38087131-38087153 ACAACCTCTCTGGGGCTCTGTGG + Intergenic
1107781806 13:43911465-43911487 TCTGGCTTCCTGGTGCTCTGAGG + Intergenic
1108314195 13:49221419-49221441 CCTGTCCCCCAGGAGCTCTGGGG + Intronic
1108596732 13:51955946-51955968 CCTGCCTGCCATGGACTCTGGGG + Intronic
1109348557 13:61146119-61146141 ACACCCTCCTTGGGGCTCTGTGG + Intergenic
1109466975 13:62747360-62747382 TCTTCCTCCCTGAGGCTCTGGGG - Intergenic
1110572384 13:77020086-77020108 CCTTCTTCCCTGGGGGTATGGGG + Intronic
1113716807 13:112515507-112515529 CATGCACGCCTGGGGCTCTGCGG - Intronic
1114555779 14:23561503-23561525 CCTTCTCACCTGGGGCTCTGTGG + Exonic
1114650863 14:24283953-24283975 CCAGCAGCCATGGGGCTCTGAGG + Intergenic
1115053476 14:29093241-29093263 CCTGCCTGCCTGGCTCTCTTCGG + Intergenic
1115514605 14:34173130-34173152 GCTTCCTGCCCGGGGCTCTGTGG + Intronic
1115515651 14:34182354-34182376 TCTCCCTCCTTGTGGCTCTGAGG - Intronic
1115728550 14:36243361-36243383 CCTGCCTCCTTGCTGCTTTGGGG - Intergenic
1117487425 14:56212460-56212482 CCTGCCTCCCTGGGATTGGGGGG + Intronic
1118008050 14:61582980-61583002 CCTGGCTCCCTTGGGGGCTGTGG - Intronic
1118311423 14:64696389-64696411 CCTGCATCCCTGTGGCCCAGTGG - Intergenic
1118751715 14:68812575-68812597 CCTGCCCCTCTGGGCCTCTTGGG + Intergenic
1118901234 14:69987563-69987585 CCTGCGTCCCTGGACCTCTTGGG + Intronic
1119217513 14:72880480-72880502 CAGGCCTCCCTGGGGCTGTTGGG + Intronic
1119479319 14:74949814-74949836 CTTGGCTCCCTGGAGCTTTGAGG + Intronic
1120251968 14:82069258-82069280 CTTGACTTCCTGGGGCTTTGGGG - Intergenic
1120756306 14:88247528-88247550 CCTGGCTCCCTGAGGACCTGAGG - Intronic
1121100067 14:91244460-91244482 ACTGCCTTCCTGGGGCCCTGAGG - Exonic
1121324837 14:93013826-93013848 TCCGCCTCCCTGGGTCTATGTGG + Intronic
1121521675 14:94590345-94590367 TGTGTCTCCCTGGGGCTGTGTGG - Intronic
1121981266 14:98456635-98456657 CCTGCCTTCCTGGGTCACTGTGG - Intergenic
1122074151 14:99224914-99224936 CCTGTCCCTGTGGGGCTCTGTGG - Intronic
1122133601 14:99620217-99620239 CCTGACTCCCTGGGGAGCTGAGG - Intergenic
1122339340 14:101018233-101018255 CCTGCCTTCCAGGGGCTCAGAGG - Intergenic
1122416374 14:101551558-101551580 CCTGCCCCCCTGGGCCTCTGTGG - Intergenic
1122672845 14:103385412-103385434 CTTGGCTCCGTGAGGCTCTGAGG + Intronic
1122717917 14:103706510-103706532 CATGCCTGCCTGGGTCTCTCAGG - Intronic
1122807900 14:104269925-104269947 CCAGCTTCCCTGGGTCTCCGCGG - Intergenic
1122858555 14:104571882-104571904 CCACCTTCCCTGGGGCTCTCGGG - Intronic
1122871851 14:104642367-104642389 ACAGCCTGCCTGGGGCTCGGGGG + Intergenic
1123047749 14:105526923-105526945 CCCTCCTCCCGGGGGCTCCGAGG + Intronic
1124046856 15:26158397-26158419 CCAGCTTCCCTTGAGCTCTGTGG - Intergenic
1124093951 15:26631045-26631067 CTTGCCTCCCAGCGGCACTGTGG - Intronic
1124168633 15:27352610-27352632 CCTGCCTCCCCGGGGCAGTGTGG - Intronic
1125754075 15:42050520-42050542 TATGGCTCCTTGGGGCTCTGAGG - Exonic
1128113396 15:65090434-65090456 CCTGCTCCACTGGGCCTCTGCGG + Intergenic
1128232994 15:66048459-66048481 TCTGCAGCCCAGGGGCTCTGTGG + Intronic
1128326258 15:66726012-66726034 CCTGCCACCCAGTGGCTGTGTGG + Intronic
1128551602 15:68601278-68601300 CCTGCCGCCCTGGAGCCCAGCGG - Intronic
1129276532 15:74449289-74449311 CCAGCCTCCCTGGGGTACAGTGG - Exonic
1129696306 15:77742309-77742331 TCTGCCTCCCAGAGGCTGTGGGG - Intronic
1129778259 15:78251345-78251367 CCTGACTCCCTGGAGCTCCCTGG - Intergenic
1129798356 15:78395169-78395191 CCAGCCTCACTTGGGCTCAGAGG - Intergenic
1129867928 15:78923220-78923242 CATGCCTCCCTGGTCCGCTGTGG - Intronic
1129999836 15:80036833-80036855 CCCTCCTCCCTGGGGGTCTGTGG + Intergenic
1130044382 15:80432205-80432227 CCTGCGTCTCTGGGGCACGGGGG + Intronic
1130169283 15:81495179-81495201 TCCTCCTCCCTGGGGTTCTGAGG + Intergenic
1130272928 15:82461693-82461715 CTTGCCTGCCTGGGGCACTCAGG + Intergenic
1130465277 15:84189046-84189068 CTTGCCTGCCTGGGGCACTCAGG + Intergenic
1130487411 15:84405756-84405778 CTTGCCTGCCTGGGGCACTCAGG - Intergenic
1130498989 15:84484490-84484512 CTTGCCTGCCTGGGGCACTCAGG - Intergenic
1130587569 15:85193659-85193681 CTTGCCTGCCTGGGGCACTCAGG + Intergenic
1130898814 15:88191914-88191936 CCTGGCTGCCTGGGGCTCTCAGG - Intronic
1131258665 15:90877327-90877349 CTGGCCCACCTGGGGCTCTGAGG + Intronic
1131371558 15:91886039-91886061 TCTGCCTCCCTGTGGCTCACAGG - Intronic
1132022287 15:98373127-98373149 CCTTTATCCCTGCGGCTCTGGGG - Intergenic
1132248701 15:100317402-100317424 CCTGTCTCCCTGGTGCTCATGGG - Intronic
1132404409 15:101533555-101533577 CAGGCTTCCCCGGGGCTCTGTGG + Intergenic
1132681092 16:1142032-1142054 CGTGCCTCCCTGGGGCTGGGCGG + Intergenic
1132723177 16:1327054-1327076 CCTGGCTCCCCTGGGCTTTGGGG + Intergenic
1132760871 16:1508090-1508112 CCCGCCTCCCTGGGCCCCTCCGG + Intronic
1132769166 16:1551434-1551456 TCTGCCACCCTGGGGCCCAGTGG - Intronic
1132794804 16:1714574-1714596 CCTTCCTCCCCAGGCCTCTGGGG + Intronic
1132904765 16:2276929-2276951 CTGACCTCTCTGGGGCTCTGGGG - Intronic
1133034541 16:3027517-3027539 CCTGCCTCCCAGCCGCTCCGCGG - Intronic
1133201466 16:4206912-4206934 CCTGGCTTCCTGGGGCTCCCTGG + Intronic
1133201515 16:4207056-4207078 CCCGCCTTCCTGGGGCTCCCTGG + Intronic
1133212723 16:4272274-4272296 CCTTCCTTCCTCGGGATCTGAGG - Intronic
1133579303 16:7127754-7127776 CCTGCCTCCACGGGGCTATGAGG - Intronic
1133718389 16:8471066-8471088 ACTGCTTCCATGGGACTCTGGGG - Intergenic
1133973104 16:10580822-10580844 CCCGCCTCCCTGCGGCTCTGTGG + Intergenic
1134092462 16:11398983-11399005 CCTGGGTTCCTGGGGCTCTTAGG - Intronic
1134693226 16:16204625-16204647 CCTGCCTCACAGGGGCCCTCGGG - Intronic
1134960363 16:18401350-18401372 CGTCCCACCCGGGGGCTCTGCGG - Intergenic
1135304651 16:21357594-21357616 CCTGCCTCACTGGGGGTGTGAGG + Intergenic
1135829519 16:25761075-25761097 CCTGACTCCTTTTGGCTCTGGGG - Intronic
1136089214 16:27906471-27906493 CCCGCTTCCCTGAGGATCTGAGG + Intronic
1136301394 16:29336721-29336743 CCTGCCTCACTGGGGGTGTGAGG + Intergenic
1137407560 16:48201858-48201880 CATCCCTCCTTGAGGCTCTGAGG + Intronic
1137618830 16:49862614-49862636 TCTGCCTCTCTGGGGCTCTCTGG + Intergenic
1137701937 16:50503685-50503707 CGCCCCTCCCTGGGGCCCTGTGG - Intergenic
1138229361 16:55326071-55326093 CCCGGCCTCCTGGGGCTCTGGGG + Intronic
1138630821 16:58293142-58293164 CCTGCCTCCCTGGGGTTAGAAGG - Intronic
1138799679 16:60012847-60012869 CCTGCCTCCGTGCAGCTCCGGGG - Intergenic
1139138615 16:64234142-64234164 CCACCCTCTTTGGGGCTCTGTGG + Intergenic
1140200551 16:72891290-72891312 CCTGCCTCCTGGAGGCTCTTAGG - Intronic
1141391739 16:83670441-83670463 CCTGCTTCCCTGGGGTTTTGTGG + Intronic
1142063091 16:88043418-88043440 CCTGCCTCACTGGGGGTGTGAGG + Intronic
1142159988 16:88552395-88552417 CCTGCCTGCCACAGGCTCTGTGG + Intergenic
1142196844 16:88742915-88742937 GCTGCCTCCCTGGGGCTGAGGGG + Intronic
1142218517 16:88841598-88841620 CCGGCCTCCCTGTGGGTGTGCGG + Intronic
1142249322 16:88983891-88983913 CCAGCCTCCCTGGGGGTCCCAGG + Intergenic
1142262488 16:89049513-89049535 CCCTCCTCCCTGGGCCTGTGAGG + Intergenic
1142281232 16:89148755-89148777 CCTGCATCCCTGTTGCTCTGGGG - Intronic
1142304101 16:89275932-89275954 CCTGACTCCCTGTGGGCCTGAGG - Intronic
1142308964 16:89301031-89301053 CTGGCCTCCCTGGGGTTCTGGGG - Intronic
1142411233 16:89918235-89918257 GCTGCAGCCCTGGGGCTGTGGGG - Exonic
1142416584 16:89946711-89946733 CCTGCCTGGCTGAGCCTCTGTGG - Intergenic
1142431612 16:90031533-90031555 CCAGCTCCTCTGGGGCTCTGTGG - Intronic
1142487960 17:259030-259052 CGTGCCTCCCCGGGGCTCTGTGG + Intronic
1142567973 17:852890-852912 CATGAGTCCCTGGGACTCTGAGG - Intronic
1142992269 17:3739315-3739337 CCTGCCCTCCTGGTGCTCTTAGG - Intronic
1143633006 17:8149471-8149493 CCTGCCCACCTGGGGCACAGGGG - Exonic
1143772714 17:9178799-9178821 CCTGCCTCCCTGAAGCTAGGCGG - Intronic
1144424564 17:15129782-15129804 CCAGCCTCCCTGGCACTCAGAGG + Intergenic
1144651970 17:17013023-17013045 GCTGCCTCCCGGCTGCTCTGAGG + Intergenic
1144707591 17:17379902-17379924 GCTGCGGCCCTGGGCCTCTGAGG - Intergenic
1145058431 17:19717655-19717677 CCTTCCTCCTCGCGGCTCTGGGG - Intronic
1145960297 17:28883285-28883307 CCTGCCTACCTCTGGGTCTGGGG - Intronic
1146551907 17:33787723-33787745 CCTACCTCCCAGGTGCTCAGTGG - Intronic
1146570463 17:33948299-33948321 CCAGTCTCTCTGGAGCTCTGTGG - Intronic
1146662722 17:34675312-34675334 CCTGCCTCCCTGGGCATCAGGGG - Intergenic
1146687481 17:34851041-34851063 CCTGGCTCCTTGGTGCTCTTTGG - Intergenic
1146739194 17:35266637-35266659 TGTGCCTCCCTGGGGGACTGTGG - Exonic
1146903126 17:36601111-36601133 CCTGCCTTCCTGGATCGCTGGGG + Intergenic
1147017704 17:37505796-37505818 CCCGCATCCCAGGAGCTCTGTGG + Intronic
1147246617 17:39125300-39125322 TCTGCCTCGCTGAGGGTCTGGGG + Intronic
1147362855 17:39942635-39942657 CCTGCCTGCCAGGGGTGCTGTGG - Intronic
1147600121 17:41740133-41740155 GCTCACTCCCTGGGGATCTGTGG - Intergenic
1147729450 17:42589015-42589037 TCTGCCTCCTTGGGGGGCTGAGG + Intronic
1147925357 17:43942388-43942410 TCAGCCTGCCTGGGGCTCTGGGG - Intronic
1147970358 17:44216171-44216193 ACTGACTGCCTGGGCCTCTGCGG - Intronic
1148209706 17:45800740-45800762 CCTGACCCCTGGGGGCTCTGGGG + Intronic
1148449262 17:47764474-47764496 CCTGCCTTCCTGTGGCTCAATGG + Intergenic
1148682787 17:49484265-49484287 CCTGCCTGCAGGGGGCTGTGAGG + Intergenic
1148913102 17:50953866-50953888 CCTGCCTCCCTGGAGCTTGAAGG - Intergenic
1148960508 17:51388631-51388653 TCTGCCTCTCTGAGGGTCTGAGG + Intergenic
1149998116 17:61415570-61415592 CCAGCCTCTCTGAGGCTCTGCGG - Intergenic
1150295445 17:64004975-64004997 CCTGCCTCCCTGAGCTCCTGGGG - Intronic
1150621337 17:66809835-66809857 CCTTGCTCCGTGAGGCTCTGTGG + Exonic
1151188705 17:72382204-72382226 CCAGCCTCCCTGAGGCTCATAGG + Intergenic
1151484652 17:74390938-74390960 ACGGTCTCCATGGGGCTCTGAGG + Intergenic
1151539738 17:74758882-74758904 GCAGCCCCCCTGGGGATCTGTGG - Intronic
1151558517 17:74859240-74859262 CCATCCTCTCTGGGGCTCTTTGG - Intronic
1151576747 17:74956224-74956246 CCTGCCTCCCTCGTGGTATGGGG - Intronic
1151892703 17:76960076-76960098 CTTGCCTCCTGGAGGCTCTGTGG + Intergenic
1151943980 17:77309366-77309388 CCTCCCTCTGTGGGCCTCTGTGG + Intronic
1151963336 17:77418935-77418957 CCTGTCTCCCAGGGTCCCTGCGG + Intronic
1151976706 17:77487590-77487612 CCTGCCTTCCTGGAGCACAGGGG + Intronic
1151976752 17:77487759-77487781 CCTGCCTTCCTGGAGCACAGGGG + Intronic
1152031604 17:77846563-77846585 CCTGGGTGCCAGGGGCTCTGTGG - Intergenic
1152036721 17:77877971-77877993 GGTCCCTGCCTGGGGCTCTGAGG + Intergenic
1152217601 17:79042793-79042815 CCTGACTGGCTGAGGCTCTGGGG + Intronic
1152509366 17:80774982-80775004 CCTTCCTCCCTCGGGCTCCTGGG + Intronic
1152516063 17:80825644-80825666 CCAGGCTCTCTGGGCCTCTGTGG - Intronic
1152589395 17:81203986-81204008 CCCGCCTTCCTGCGGGTCTGCGG - Intronic
1152742776 17:82025611-82025633 CCTGCTTCCCCTGGGCTCTCAGG - Intronic
1152749906 17:82057830-82057852 CATGCCTCCCTGGGTCTGAGAGG + Intronic
1152798137 17:82317863-82317885 CCAGCCTGCCTGGTCCTCTGGGG + Intergenic
1153413557 18:4820941-4820963 CCTGGCTCTCTTGGGTTCTGAGG - Intergenic
1154012514 18:10587890-10587912 CCAGACTTTCTGGGGCTCTGTGG + Intergenic
1154071845 18:11159795-11159817 CCTGCTGTCCTGGGGCGCTGTGG - Intergenic
1154306432 18:13234104-13234126 CCTCTCTCCCTGGGTTTCTGCGG + Intronic
1155179727 18:23334000-23334022 CCTGCCTTCCTTGGGCTCACAGG + Intronic
1156327363 18:36086166-36086188 ACTGCCTCTTTGGGGCTCTGTGG + Intergenic
1156368967 18:36455690-36455712 CCTGCCTTCCTCAGGCTCTGAGG + Intronic
1157105594 18:44771647-44771669 CGGGCCTCCCTTGGGCTCAGAGG + Intronic
1157713155 18:49863803-49863825 CTTGCCACCCTGGGGGACTGAGG + Intronic
1157807988 18:50672559-50672581 CCTCTGTCCCTGGGTCTCTGGGG + Intronic
1158010074 18:52718586-52718608 CCTGCCTCCGTGTGGCTCTGTGG + Intronic
1158346492 18:56521551-56521573 CCAGGCTCCCTGTGGCTCAGAGG - Intergenic
1159798427 18:72868990-72869012 CCGCCCTCCCTCGGCCTCTGCGG + Intergenic
1160258921 18:77273110-77273132 GCTGCCATCCTGGGGTTCTGAGG + Exonic
1160409603 18:78666904-78666926 CCTGCCTCCCAGGGACAGTGTGG - Intergenic
1160579651 18:79876297-79876319 CCTGCCTGGCTGGGGCCCTTCGG - Intronic
1160917362 19:1503632-1503654 CCTGCCGCCAGGGGGCACTGCGG + Intergenic
1160930090 19:1566449-1566471 CCTGCCTCCCCGGGGCCCTCGGG - Intronic
1160982501 19:1822815-1822837 CCTGCCTCCCTGGCGCTGGCTGG - Intronic
1161042352 19:2116870-2116892 CCTGCCTCGCTGGCCCTGTGTGG - Intronic
1161057617 19:2198503-2198525 CCTGTCTCTCTGGGGCTGAGTGG + Intronic
1161318606 19:3630868-3630890 CCTCCCTCGCGGGGGATCTGAGG + Exonic
1161343041 19:3753114-3753136 CCTTCTGCCCTGGGGCTTTGGGG + Intronic
1161512320 19:4678687-4678709 TCTGCCTCCCTCCTGCTCTGCGG + Intronic
1161627909 19:5337841-5337863 CCTGCCTCCCAGGGGATTTCAGG - Intronic
1161713832 19:5864518-5864540 CCTGGGTCCCTGGCCCTCTGTGG + Intergenic
1161716274 19:5877771-5877793 CCTGGGTCCCTGGCCCTCTGCGG + Intronic
1161955954 19:7495163-7495185 CCAGCTTCCCTGGAGCTCTAAGG + Intronic
1162341643 19:10094831-10094853 CTGGTCTCTCTGGGGCTCTGGGG + Exonic
1162345863 19:10117574-10117596 CCTGCCTCCCTGGGCTCCTAAGG + Intronic
1162789057 19:13053764-13053786 GCTCCCTCCCTGGGAGTCTGGGG + Intronic
1162932384 19:13963471-13963493 CCCGCGTCCCTGGGGGTCTCAGG - Intronic
1163126864 19:15249003-15249025 CCAGCCTTCCTGGTTCTCTGGGG - Intronic
1163173545 19:15549246-15549268 GCTGGCTCCCTGGGGCGCAGGGG - Intronic
1163190933 19:15676041-15676063 CCTGAGTCCCTGGAGTTCTGAGG + Intronic
1163397220 19:17070682-17070704 CCTGGGCCCCTGGGGCTCTAGGG - Intronic
1163414555 19:17178181-17178203 TCTGCCTCCCTGGAGGGCTGGGG + Intronic
1163613474 19:18312523-18312545 CCTCCCTCCCTGGGCCTCATGGG - Intronic
1163686507 19:18714878-18714900 CCTGCCCCCACTGGGCTCTGGGG + Intronic
1163694939 19:18759392-18759414 CCTCCATCTGTGGGGCTCTGCGG + Intronic
1163836420 19:19577482-19577504 CCTGTCACCCTCGGGCCCTGTGG + Intronic
1164259772 19:23559478-23559500 CCTGCCTACTTGGGGCATTGTGG - Intronic
1164872430 19:31657056-31657078 CCTCCCTCCCTGTGGAACTGTGG - Intergenic
1164955115 19:32376531-32376553 CCTTGCCCCCTGGGCCTCTGTGG - Intronic
1165311152 19:35030245-35030267 CCGACCCCGCTGGGGCTCTGAGG - Intergenic
1165359765 19:35329099-35329121 CCTGCTTCTCTATGGCTCTGAGG - Intronic
1165885368 19:39074401-39074423 CCTGCCTTCCTGGAGCTGTTAGG + Intergenic
1166194737 19:41198365-41198387 CCTGCCTCCCTGTCTCTCTCTGG + Intronic
1167416973 19:49379327-49379349 CCTGCCTACCTGGGAGGCTGAGG - Intergenic
1167547898 19:50140263-50140285 CCTGCCTCCCTGAGGGCCCGAGG + Intergenic
1167942962 19:52962460-52962482 CCGGCCACCCTGGGGCTGCGGGG + Intronic
1168115575 19:54220041-54220063 CTTGTGTCCCAGGGGCTCTGAGG - Intronic
1168118562 19:54239787-54239809 CTTGTGTCCCAGGGGCTCTGAGG - Intronic
1168121379 19:54254201-54254223 ACAGGCTCCCCGGGGCTCTGAGG - Intronic
1168132921 19:54332352-54332374 ACAGGCTCCCCGGGGCTCTGAGG - Intergenic
1168133494 19:54336173-54336195 CGTGGCTTCCTGGGGCTCTGAGG - Intronic
925048053 2:789590-789612 CCTGGCTCCCACTGGCTCTGTGG - Intergenic
925407221 2:3613492-3613514 TCTGCCTCCCTGGGACCCAGAGG - Intronic
925613170 2:5720420-5720442 CCTTCTTTCCTGGGGTTCTGGGG - Intergenic
925997342 2:9304126-9304148 CCTGCTTCCCTGGATCCCTGAGG + Intronic
926953833 2:18272143-18272165 CCTGGCTCCCGGGGGCTCAAGGG + Intronic
926956892 2:18311450-18311472 CCTGGCTCCCTGAGGCTCTCGGG + Intronic
927393141 2:22618802-22618824 ACTGCCACCTTGGGGTTCTGGGG - Intergenic
927574480 2:24189967-24189989 CCTGCCTCTTTGGGGCTATGTGG + Intronic
927648939 2:24899173-24899195 CTGACCTCCCTGGGCCTCTGTGG - Intronic
927962881 2:27251533-27251555 ACTCCCGTCCTGGGGCTCTGGGG - Intergenic
928595699 2:32856984-32857006 CCTGCCACCCTGGGGATAGGTGG - Intergenic
928984424 2:37166935-37166957 CATGCCTACTTGAGGCTCTGTGG + Intergenic
929105301 2:38359392-38359414 CCTCCCTCTCCCGGGCTCTGGGG - Intronic
929285191 2:40127736-40127758 CCTGCCTCTCTGGAGCCCAGGGG - Intronic
929467351 2:42156941-42156963 CCTGCCCACCTGGGGTGCTGAGG - Intergenic
929713766 2:44290779-44290801 CTTGCCTCCATGGGGTTGTGGGG + Intronic
929758988 2:44790687-44790709 CCCACCCCCCTGGGGGTCTGTGG + Intergenic
929830986 2:45346013-45346035 CCAGTCTCCCAGGGGCTGTGTGG + Intergenic
929967653 2:46547685-46547707 GCTTCCTGCCTGGGCCTCTGTGG + Intronic
930025367 2:47026165-47026187 CTAGCCTGCCTGGGTCTCTGAGG + Intronic
930036467 2:47088535-47088557 CCTGCCTCTAGGGGGCTATGAGG + Intronic
931168739 2:59779551-59779573 CCTGGCTCACTGTGGCTTTGTGG + Intergenic
931721812 2:65072296-65072318 CCCTACTGCCTGGGGCTCTGGGG - Exonic
932232609 2:70095012-70095034 CTTACCTCCCTGGGGTTCTGGGG + Intergenic
932278282 2:70468006-70468028 CCTGCCTCCTTGGTCCTCTGCGG + Intronic
932682338 2:73836698-73836720 TCTTCCTCCCTGGGGCTCAGAGG + Intronic
933042459 2:77487140-77487162 CCTGGCTCCCATTGGCTCTGTGG - Intronic
933700200 2:85249586-85249608 CCTGCTTTTCTGGGGGTCTGCGG + Intronic
933810503 2:86030009-86030031 TCTGCCTCCCGGGGATTCTGGGG - Intronic
934567101 2:95346991-95347013 CCGGGCTGCCTGGGGCCCTGGGG - Intronic
934730017 2:96650484-96650506 ACTACCTCACTGGAGCTCTGTGG - Intergenic
935276623 2:101480903-101480925 GCTTCCTCCCGTGGGCTCTGTGG - Intergenic
935423218 2:102892663-102892685 ACTGCATGCGTGGGGCTCTGTGG + Intergenic
936094924 2:109524082-109524104 CCAGCCTCACTGGGACTCCGTGG + Intergenic
936119020 2:109725524-109725546 CATGCCATCCTGGGGCTCTGTGG + Intergenic
936268584 2:111030608-111030630 CTTGCTTCCCTGCAGCTCTGCGG - Intronic
936427996 2:112435796-112435818 CCTGGGTCCCTGGGGCTCTCCGG + Intergenic
936500083 2:113059822-113059844 CCTGCCTCCCTGCTACTCTTTGG + Intronic
937288996 2:120770630-120770652 CTTGCCTCTCTCGTGCTCTGAGG + Intronic
937289065 2:120771020-120771042 TCTGGCTGCCTGTGGCTCTGTGG + Intronic
937973258 2:127565950-127565972 ACTGCCTGCCTGGGCCTCTCTGG + Intronic
937988723 2:127650446-127650468 CCTGCCACCCAGGAGATCTGAGG - Intronic
938201186 2:129374365-129374387 CCGGCCTCCCTGGGTCCCTGTGG + Intergenic
938383453 2:130849104-130849126 CCACCCTCCCTTGGGATCTGGGG + Intronic
939084811 2:137707218-137707240 ACATCCTCTCTGGGGCTCTGTGG - Intergenic
941394259 2:164955354-164955376 ACTGGCTCCCTGCAGCTCTGCGG - Exonic
941401180 2:165032807-165032829 CCTGCCTCCCTGAGGCAGAGAGG - Intergenic
943920427 2:193699920-193699942 CCTGCCATGATGGGGCTCTGGGG - Intergenic
944962480 2:204890718-204890740 CCTGCCTCCCTGTGGCTAGCAGG - Intronic
945952819 2:216055714-216055736 CCTGTGGCCCTGGGGCTCTGGGG - Intronic
946054351 2:216887984-216888006 CCTGCCTCCTTAGTGCTCTGTGG + Intergenic
946129388 2:217594052-217594074 CCTGCCTGACTGCTGCTCTGGGG + Intronic
946154731 2:217800033-217800055 CCTGCCTCCCAGGCCCTCTGCGG - Exonic
946191593 2:218010528-218010550 CCTGCTTCCCGGGCGCGCTGCGG + Intergenic
946412578 2:219522577-219522599 CCCGCCTGGCTGGGGATCTGAGG + Intronic
946643090 2:221805000-221805022 GCGGCCTCCCAGGGGCTCTTGGG - Intergenic
947472286 2:230411067-230411089 CCTGCCTCCTTGGCACCCTGAGG + Intergenic
947771675 2:232675401-232675423 CCAGCCTCCCTGAGGCTGAGAGG + Intronic
947773050 2:232686238-232686260 GCGGCCTCCCGGGGACTCTGTGG - Intergenic
947795176 2:232890045-232890067 CCTGCCTCACTGGGCCTGTCAGG + Intronic
947795214 2:232890198-232890220 CCTGCCTCACTGGGCCTGTCAGG + Intronic
947795225 2:232890237-232890259 CCTGCCTCACTGGGCCTGTCAGG + Intronic
947840143 2:233202468-233202490 CCAGCCTCCCTGGAGCTCCATGG + Intronic
947905550 2:233759148-233759170 CCTGCCTGCCTTGTGTTCTGTGG - Intronic
947999869 2:234558990-234559012 CCTGCCTCACAGGGGTTCTGAGG + Intergenic
948322487 2:237081833-237081855 TCTCCCTTCCTGGGGCTCTTTGG - Intergenic
948464131 2:238144193-238144215 CCAGCCTCCCGGGAGCTATGGGG - Intronic
948795110 2:240398716-240398738 CCTCCCTCCCTGGGCTGCTGGGG + Intergenic
949027696 2:241774135-241774157 CCTGGGGCCCTGGGGCCCTGGGG + Intergenic
949031689 2:241800129-241800151 ACTGTCTCCGTGGGGCCCTGAGG + Intronic
949032815 2:241805005-241805027 CCTGGCTGCCAGGGGCTCAGCGG + Intergenic
949072245 2:242032822-242032844 CCTGCCTCATAGGGCCTCTGAGG + Intergenic
1168831652 20:848364-848386 CCTGCAGCCTTGGGGATCTGTGG + Intronic
1168959154 20:1856726-1856748 GCTACCTCCCTGGGGATCTGTGG - Intergenic
1168962697 20:1879911-1879933 TCTGAGTCCCTGGGGCTCAGGGG + Intergenic
1168979982 20:1996067-1996089 CCTCCCTCCCTGGGTGGCTGGGG - Intergenic
1169146628 20:3256835-3256857 CCCTCCTCCCTTGGCCTCTGAGG - Intronic
1170649288 20:18225247-18225269 CCTGCCACCCTGCAGCTCAGAGG - Intergenic
1170957903 20:20998149-20998171 CTGGCCTCCCTGGGGCTCTGTGG - Intergenic
1171053546 20:21883732-21883754 CCTGGCCCCCAGTGGCTCTGAGG - Intergenic
1171145545 20:22778277-22778299 CTTGCTTCCCTGTGACTCTGAGG + Intergenic
1172143766 20:32742732-32742754 CAGGCCCCACTGGGGCTCTGTGG - Intronic
1172189802 20:33055043-33055065 CCAGGCTCACTGGGCCTCTGAGG + Intergenic
1172442502 20:34976149-34976171 CCTGCCTCCCAGAGGCTCTCTGG + Intronic
1172442633 20:34976944-34976966 CCTGCCTCCCAGAGGCTCTCTGG - Intronic
1172581248 20:36050622-36050644 GCTGCGTCCCGGCGGCTCTGCGG + Intergenic
1172894207 20:38288022-38288044 GCTGCCTCCGTGGCCCTCTGTGG - Intronic
1173248091 20:41349922-41349944 CCGGCCTTTCAGGGGCTCTGTGG + Intronic
1173590030 20:44217474-44217496 CCTCCCCTCCTGGAGCTCTGAGG - Intergenic
1173595703 20:44257519-44257541 CCTGTGGCTCTGGGGCTCTGGGG - Intronic
1175216516 20:57394264-57394286 CCTGCCTGACTGGGGCAGTGTGG + Intronic
1175286487 20:57840253-57840275 CTTTCCTCCCATGGGCTCTGTGG + Intergenic
1175422026 20:58840659-58840681 TCCCCTTCCCTGGGGCTCTGGGG - Intronic
1175539779 20:59741163-59741185 CCATGCTTCCTGGGGCTCTGAGG + Intronic
1175709231 20:61206080-61206102 CCTGGCTTCCTGGGGCTGGGGGG - Intergenic
1175799297 20:61792070-61792092 CTCTCCTCCCTGGGGCTCTGGGG - Intronic
1175862261 20:62156758-62156780 CCTGCCTGCCTGGGGCCTTGGGG - Intronic
1175903272 20:62368218-62368240 CCTACTTCCCTTGGGCTCCGGGG + Intergenic
1176100129 20:63361010-63361032 CCTGCCTCCCTCTGGCTCTGGGG + Intronic
1176142186 20:63549662-63549684 GAGGCCTCCCTGGGGCTCTGCGG - Intronic
1176246990 20:64102176-64102198 CCTCCCTCCAGGGGGCGCTGTGG + Intergenic
1177176385 21:17704637-17704659 CCTGCCTCACAGGGGCCCTTGGG + Intergenic
1178404595 21:32313747-32313769 CCTGCATGCCTGGGGCTCTTGGG - Exonic
1179341650 21:40516494-40516516 CCTCTCTCCATGGGGCTGTGAGG + Intronic
1179537701 21:42062998-42063020 CCTGCCTCTCCCAGGCTCTGGGG + Intronic
1179639026 21:42735081-42735103 CAAGCCTTCCTGGGGATCTGGGG - Intronic
1179879437 21:44287239-44287261 CCAGCCTGCCTGGGGCTGTGGGG + Intronic
1179882544 21:44299679-44299701 CCTGCCCCCCAGGGGCCCTCAGG - Intergenic
1179994886 21:44969443-44969465 CCTGCCTCCCTGCGGGGCTCTGG + Intronic
1180054613 21:45351374-45351396 TCCGCCTACCTGGGGCTCAGCGG + Intergenic
1180059365 21:45376650-45376672 CCTGCCTGCCTATGTCTCTGGGG + Intergenic
1180129424 21:45817548-45817570 GCTGCCTCGCTGGGGGGCTGAGG - Intronic
1180180593 21:46117171-46117193 GCTGCCTCCCAGAGGCCCTGAGG - Intronic
1180606885 22:17065689-17065711 CCTCCCTCCCTGATTCTCTGGGG - Intergenic
1180699044 22:17771895-17771917 CCTCCCTCCCAGGGGCTCACAGG + Intronic
1180905520 22:19408214-19408236 CCTGATTCCATGGGGCTTTGGGG - Intronic
1180947673 22:19705553-19705575 CCTGGCTCCCAGGGGCTCCCAGG + Intergenic
1180955251 22:19738541-19738563 CAGCCCTCCCTGGGGGTCTGGGG + Intergenic
1180968634 22:19803423-19803445 CCTGCCTCCCAGGGACAATGTGG - Intronic
1181001881 22:19991644-19991666 CCTGCTCCCCTGGGGCTCTGGGG - Intronic
1181974729 22:26720867-26720889 CCTGCCTGCCAGGGTCTCTGAGG - Intergenic
1181985786 22:26799128-26799150 CCTGCCTGGGGGGGGCTCTGGGG - Intergenic
1182115949 22:27756452-27756474 TCTCCTTCCCTGGGGCTCAGTGG - Intronic
1182124072 22:27803913-27803935 CCTAGGACCCTGGGGCTCTGGGG + Intergenic
1182269782 22:29146053-29146075 CCTGCCTCCCTGGTCTGCTGAGG + Intronic
1182684058 22:32107160-32107182 CCTGCCTCCCTGGGGCAGGCAGG + Intronic
1182906479 22:33941865-33941887 TGTGCCTCCCTGGGACTCTGTGG - Intergenic
1183228095 22:36563776-36563798 CCTGCCTCCCTGGGAGATTGGGG - Intergenic
1183250321 22:36725763-36725785 CCGGGCTCCCTGTGGCTCTCCGG - Intergenic
1183304673 22:37076264-37076286 CCTGCCTCCCTGTGACACTGTGG + Intronic
1183666635 22:39249973-39249995 CCTGCCTCCCTGGCACTCACAGG - Intergenic
1183685866 22:39361115-39361137 CCTGCTTCCCTTGGGCTCTGTGG + Intronic
1184244604 22:43229558-43229580 GCTGCCTCCCCAGGGCCCTGGGG - Intronic
1184416168 22:44352963-44352985 CCTGCCTGCCCCGGGCTCTGAGG + Intergenic
1184707499 22:46224575-46224597 TGTGCCTTCCTGAGGCTCTGTGG - Intronic
1184727618 22:46355916-46355938 CCTTTCTCCCTGGGGGCCTGAGG + Intronic
1184779131 22:46637564-46637586 CCAGCCTTACAGGGGCTCTGAGG + Intronic
1185008839 22:48301759-48301781 ACTGCCTCCCTGAGGCTCTGAGG - Intergenic
1185047697 22:48537253-48537275 CCCGGCTCCCTGGGGACCTGAGG + Intronic
1185068894 22:48645595-48645617 CCTGCTTCCCTCGTGCCCTGTGG + Intronic
1185097875 22:48821534-48821556 CCCGCCCCCCAGGGGCTCTTTGG - Intronic
1185219760 22:49623459-49623481 CCTGCCCAGCGGGGGCTCTGGGG - Intronic
1185225180 22:49648056-49648078 CCGCCCTCCCAGGGGCTGTGGGG - Intronic
1185293552 22:50041186-50041208 CCTGCCTGTCTCGGGCTGTGGGG + Intronic
950888152 3:16378695-16378717 CCTTGCTCCCTGGTGCTCTCAGG + Intronic
951859937 3:27241036-27241058 TCTGCCTCCCTGTAGTTCTGGGG - Intronic
953118393 3:40015327-40015349 CCTTGCTCCCTGGAGCTCTCAGG - Intronic
953246733 3:41199877-41199899 GCTGCCTCTCTGGGGCCCTGGGG + Intronic
953255822 3:41289630-41289652 CCTGTCTACCATGGGCTCTGTGG - Intronic
953407630 3:42667291-42667313 CCCGGCTCCTTGGGGCTCTCTGG + Intergenic
953413876 3:42704552-42704574 CCAGCCTTTCTGGGCCTCTGGGG - Intronic
953544667 3:43855693-43855715 TTTGTCGCCCTGGGGCTCTGGGG + Intergenic
953732750 3:45464294-45464316 CCTGCCTCACTGCTTCTCTGAGG - Intronic
954107513 3:48417404-48417426 GCTGCCTTCCTGGGGCTCCTGGG - Intronic
954291249 3:49651139-49651161 CTTGCCTCCCTGGGTGGCTGAGG + Intronic
954291337 3:49651585-49651607 CCTGTGTCACTGAGGCTCTGTGG - Exonic
954325563 3:49861561-49861583 CCTCCCTCCCCGTGGCCCTGAGG + Exonic
954372491 3:50176152-50176174 CCTGGCTCCCTGGGGAGATGTGG + Intronic
954429670 3:50463825-50463847 CCTCCCTCCCTGGGACTCAGGGG - Intronic
954634955 3:52066220-52066242 CCTGACTCCCAGGGACTATGGGG + Intergenic
954691316 3:52397078-52397100 CCTGCCAGCCTGGGGTTCTGGGG + Intronic
954863288 3:53708047-53708069 TCTGCCACCCTGGGGCTTGGTGG + Intronic
954871201 3:53768825-53768847 GCCTCCTCCCTGGGGATCTGGGG - Intronic
955327611 3:58021256-58021278 CCTGCCTCCCAGGGGACCTGAGG + Intronic
955751486 3:62189135-62189157 GATGCCTCCCAGGGGTTCTGCGG + Intronic
956747647 3:72322364-72322386 CCTGTCTTCTTGGGGCTCTCAGG - Intergenic
957665089 3:83217291-83217313 ACTCCCTCTTTGGGGCTCTGTGG - Intergenic
958955959 3:100466359-100466381 CCTGCCCCCCTGTTGCTCTCAGG + Intergenic
961183883 3:124897891-124897913 CCTGCCTCCCTTGGGGTGTTGGG + Intronic
961678713 3:128584324-128584346 CCTTCCTCCCAGGGGATCTTTGG + Intergenic
962437813 3:135382816-135382838 CCTGCCTCTCAGAGGCACTGGGG + Intergenic
967303161 3:188036775-188036797 CCTCCCTACCTAGGGCTCAGAGG + Intergenic
967882902 3:194314296-194314318 TCTCCCTCCCTGGGGCTGTAGGG + Intergenic
967929885 3:194683238-194683260 CCTGCCTCTGTGGGCCACTGGGG + Intergenic
967989554 3:195120952-195120974 CCTACCTCCCTGGGGCTCACAGG + Intronic
968526360 4:1059612-1059634 ACTCCCTCCCTGGGGGTCTCTGG + Intronic
968565037 4:1307644-1307666 CCAGCTTCCCAGGGTCTCTGGGG - Intronic
968568185 4:1326021-1326043 CCTGCCTTCCAGGGGCTCAGAGG - Intronic
968609205 4:1549489-1549511 CCCTCCTGCCTGGGGCTCTGGGG - Intergenic
968808328 4:2788859-2788881 CCTGCTTCCCTGGGGATAGGAGG - Intergenic
968913662 4:3487905-3487927 CCTGGCTCCTTGGTGCACTGAGG - Intronic
969058153 4:4414811-4414833 CCCCACTGCCTGGGGCTCTGAGG - Intronic
969238801 4:5886720-5886742 CCTGCCTCCCAAGGGAACTGAGG - Intronic
969306071 4:6326998-6327020 CCTGCCTTCCAGGGCCTCAGAGG - Intronic
969469055 4:7375907-7375929 CTTGCCTCTCTGGGCCTCAGTGG + Intronic
969495499 4:7523888-7523910 CCTCCCTCCTTGGGCCCCTGGGG + Intronic
969607390 4:8209415-8209437 TGTTCCTCCCAGGGGCTCTGGGG - Intronic
969685767 4:8673231-8673253 ACTGCATCCCTGGCGCTGTGAGG + Intergenic
969867769 4:10086665-10086687 CCTGCTGCCGTGGAGCTCTGGGG - Intronic
970792328 4:19873305-19873327 TCTGCCTCCCTGGGGGTTGGGGG + Intergenic
972645919 4:40967439-40967461 ACTCCCTCTTTGGGGCTCTGTGG + Intronic
975741920 4:77437461-77437483 GCTGCCTCCTGGGGGCTCTTGGG + Intergenic
975910122 4:79258069-79258091 CCTGGCTCCCACTGGCTCTGTGG - Intronic
978198391 4:105996918-105996940 TCTGCCTCCCTGGTGCTCAAAGG - Intronic
980565416 4:134532987-134533009 CCTGGCTGCCTGGTGATCTGGGG + Intergenic
981534142 4:145782048-145782070 CCTGCCTCACTGCGACTCCGGGG - Intronic
981887335 4:149692165-149692187 ACAGGCTCCCTGGGGCACTGTGG - Intergenic
982918820 4:161249271-161249293 ACACCCTCTCTGGGGCTCTGTGG - Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
983715306 4:170775778-170775800 CCTAGCTCCCTCAGGCTCTGTGG - Intergenic
984620778 4:181949815-181949837 CCTGCCTCCCTGGTGGTCTATGG + Intergenic
985240893 4:187929834-187929856 CCTGCCTCACGGGGGCCTTGAGG - Intergenic
985508368 5:298209-298231 CCTGCCTCATGGGGTCTCTGAGG + Intronic
985622804 5:964407-964429 CCGGGCTCCCCAGGGCTCTGCGG - Intergenic
985643792 5:1075661-1075683 CGTGGCTCCCTGGGCCCCTGTGG + Intronic
985709397 5:1419866-1419888 GCTGCCTCCCTGGGGCTTCCTGG + Intronic
987370261 5:17186582-17186604 CCTTGCTCCCTGCTGCTCTGTGG + Intronic
987962085 5:24823838-24823860 CCTGCCTCCCTGGGGCTGAGTGG - Intergenic
988868964 5:35367059-35367081 CCTGCCTTCCTTGGACTCAGGGG - Intergenic
989187696 5:38641156-38641178 CCCTCCTCCCTGAGGCTCTGAGG + Intergenic
989240920 5:39202265-39202287 CCTGACTCCCAGGGGAGCTGGGG + Exonic
990003678 5:50922356-50922378 CCCTCCTGCCTGGGGCTCTGGGG + Intergenic
990347429 5:54884069-54884091 GCTGCCTGCCTGGGGTTCTGCGG - Intergenic
991616720 5:68504590-68504612 AATGACTCCCTGGGACTCTGTGG - Intergenic
993387726 5:87279952-87279974 GCAGCCTCCCTGGGGGTCTCAGG - Intronic
994452147 5:99956071-99956093 CCTGCCACCCTGGTGCCCTATGG - Intergenic
995141498 5:108740496-108740518 CCTGCCACCCTAGGGCTCTGTGG - Intergenic
997260073 5:132459229-132459251 CATGACTGCCTGGAGCTCTGGGG - Intronic
997358258 5:133278242-133278264 CCTGTCTCCCTAGAGCTCTGGGG + Intronic
998093047 5:139382087-139382109 CCCCTCTCCCTGGAGCTCTGGGG - Intronic
998095067 5:139392168-139392190 CCAGCTACCCTGGGTCTCTGAGG - Exonic
998264753 5:140659533-140659555 CCTGTGGCCCTGGGGTTCTGAGG + Intronic
998406398 5:141876906-141876928 CCCGCCTCCCCGGAGCTCTGGGG - Intronic
998567139 5:143225787-143225809 CCAGCTTCCCTGTGGCTGTGCGG + Exonic
999370825 5:151054180-151054202 CCTGTCTCCCTGGGACTCTAAGG + Intronic
999700268 5:154221358-154221380 TCTGCCTCCCAGGGGCTCTGGGG + Intronic
1000040559 5:157481731-157481753 CCTGCCCCCCTGGAGCCCTCTGG + Intronic
1000647303 5:163774109-163774131 CCACCCTCCCTGGTGCTTTGAGG - Intergenic
1001937198 5:175713936-175713958 CCTTCCTCCTTGGATCTCTGTGG + Intergenic
1002079484 5:176728875-176728897 TCTGCCTCCCTTGGGCCCTGTGG + Intergenic
1002164735 5:177337291-177337313 CCTGCCCTCCTGAGCCTCTGTGG + Intronic
1002521157 5:179793901-179793923 CCTGGCTCCCTGGCTCTGTGTGG + Intronic
1002643234 5:180640460-180640482 CCTGCCTGCAGGGGTCTCTGAGG - Intronic
1002715325 5:181223559-181223581 CCTGTCGCCCTGGGGCCCCGCGG + Exonic
1002827433 6:786018-786040 CCTGCCTCCCTGAAGTCCTGGGG - Intergenic
1004296560 6:14417089-14417111 TCTGCCTTCAAGGGGCTCTGAGG - Intergenic
1004692549 6:18004783-18004805 CCAGCCTCACTGGGGATGTGCGG + Intergenic
1004700970 6:18079108-18079130 CCAGCCTCCCTGGCCCTCTGTGG - Intergenic
1004839144 6:19562652-19562674 GCAGCCTCCCAGGGGCTCTTAGG - Intergenic
1005592853 6:27347363-27347385 CCAGCCTCCCTGGGAGACTGAGG + Intergenic
1005677040 6:28165176-28165198 CCTCCCTCCCAGGGTTTCTGAGG - Intergenic
1005920383 6:30396327-30396349 CCTGTCTCCCTGGGGGCCTCAGG - Intergenic
1006113516 6:31763045-31763067 CCTGGCTCCCCATGGCTCTGAGG - Exonic
1006141718 6:31933457-31933479 ACTTCTTCCCTGGGTCTCTGGGG + Intronic
1006263199 6:32894279-32894301 CCAGCCTCTCTGGGGCACTGAGG + Intergenic
1006333992 6:33411059-33411081 CCTCCGTCCCGGCGGCTCTGGGG - Exonic
1006450898 6:34105252-34105274 GAGGCCCCCCTGGGGCTCTGGGG + Intronic
1006513720 6:34534761-34534783 CCTCCCGCTCTGGGGCCCTGAGG - Exonic
1006593946 6:35179202-35179224 CCTGCCTGTCTGGGGCCCTGAGG - Intergenic
1006825280 6:36930231-36930253 CCTCCCTCCCTTGGCCTCTGTGG + Intergenic
1006938615 6:37736380-37736402 CCTTCCTCCCTGGGGACCAGTGG - Intergenic
1007421860 6:41724479-41724501 CCATCCTCCCTGGGCCTCTCTGG - Intronic
1007423174 6:41731839-41731861 CCTCCCTTCCTGGGTGTCTGGGG + Intronic
1007974018 6:46082234-46082256 CCTGCCTCACTGGGTCATTGTGG - Intergenic
1009598767 6:65771453-65771475 CCTGGCCCCCGGGGGCTCTGGGG + Intergenic
1010519784 6:76818494-76818516 ACTCCCTCTTTGGGGCTCTGCGG + Intergenic
1011129536 6:84039087-84039109 CCTGACTCCCTTGCACTCTGGGG - Intronic
1012720544 6:102736883-102736905 GCAGCCTCCCAGGGGCTCTGAGG + Intergenic
1012980310 6:105822752-105822774 TCTCCCTCCCCTGGGCTCTGGGG - Intergenic
1013038646 6:106411782-106411804 GCGGCCTCCCAGGGGCTCTCAGG - Intergenic
1013419450 6:109952751-109952773 CCTGCTTCTCTGGGACTCAGTGG + Intergenic
1013538979 6:111088509-111088531 CCTGCCTCCCTGGGCCGCAGAGG + Intronic
1013626606 6:111943868-111943890 CCCCACTCCCTGGGGCACTGTGG + Intergenic
1013650921 6:112193663-112193685 CCTCCCTCCCAGGGTGTCTGTGG - Intronic
1013673263 6:112428859-112428881 GGTGCCTTCCAGGGGCTCTGGGG - Intergenic
1014539465 6:122656572-122656594 CCTGCCTCACTGTGGGTCAGGGG - Intronic
1014961761 6:127695253-127695275 CCTGCCCCCCAGGGCATCTGGGG + Intergenic
1015136947 6:129882914-129882936 CCTGCCCCACTGTGGCTCTCAGG + Intergenic
1015525956 6:134175480-134175502 CCTGCCTCCAAGCCGCTCTGGGG + Intronic
1016199878 6:141394536-141394558 CCCGCCTCCCGCTGGCTCTGTGG - Intergenic
1016758771 6:147715474-147715496 ACAACCTCTCTGGGGCTCTGTGG - Intronic
1017257969 6:152355521-152355543 CCTGCCCACCAGGTGCTCTGAGG + Intronic
1018012471 6:159684104-159684126 TCTGCCTTTCTGGGGCTCTTTGG - Intronic
1018434521 6:163748772-163748794 CATGCTTCCCTGTGGCTCTCTGG + Intergenic
1018767792 6:166947398-166947420 CTGGCCTCTTTGGGGCTCTGAGG - Intronic
1019124175 6:169828238-169828260 CTTTCCTGCCTGGGCCTCTGTGG + Intergenic
1019261989 7:86903-86925 TCTGCTGCCCTGTGGCTCTGAGG - Intergenic
1019331835 7:464136-464158 CCTGCCGTCCTGTGGCTCCGGGG - Intergenic
1019552325 7:1609209-1609231 CCAGCATCCCTGGTGCACTGTGG - Intergenic
1019707884 7:2505067-2505089 GCTTCCTCCCAGGGCCTCTGCGG - Intergenic
1019843750 7:3475828-3475850 GCTGCCTCTCTGGCTCTCTGTGG + Intronic
1019891300 7:3949197-3949219 CCTGGGTCCCTGGGGGGCTGAGG - Intronic
1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG + Intergenic
1022993811 7:35733526-35733548 CCTGCCTCCATGGGACCCTCAGG + Intergenic
1023418040 7:39950426-39950448 CCTGCTTCCCTGGGGCCCGGAGG + Exonic
1023731386 7:43195432-43195454 TCTGCCGCCCTGTGGCTGTGTGG - Intronic
1023843335 7:44108474-44108496 CCTGCGTCCCTGGAGCCCTCAGG + Intronic
1024004667 7:45216697-45216719 CCTGCCTCAGTGGGCCTCTGAGG + Intergenic
1024243745 7:47454441-47454463 CCAGCCTCCCAGGATCTCTGTGG + Intronic
1024564946 7:50673262-50673284 CGTGCCTCTCTGGGCCTTTGCGG - Intronic
1026255192 7:68705028-68705050 CCTGGCTACCTGGGGGGCTGAGG + Intergenic
1027048040 7:75004080-75004102 TTTGCCTCCCCGGGGCTCTCGGG + Intronic
1027173261 7:75887805-75887827 CCACCCTCCCTGGGCATCTGTGG + Intronic
1029384957 7:100237535-100237557 TTTGCCTCCCCGGGGCTCTCGGG - Intronic
1029459106 7:100685304-100685326 CCTACCTCCCGGGTGCGCTGGGG - Intronic
1029551150 7:101237749-101237771 TCTGCCTCCCTCCTGCTCTGTGG + Exonic
1029666096 7:101996202-101996224 CATGCCTTCCTGGGTCTGTGGGG - Intronic
1031963976 7:128014020-128014042 CTTCCTTGCCTGGGGCTCTGAGG + Intronic
1032480028 7:132238943-132238965 CCTGCCTCACTGAGTCACTGGGG - Intronic
1033223676 7:139544711-139544733 ACTGCAGCCCTGGTGCTCTGGGG + Exonic
1034346801 7:150390367-150390389 CCTGGCATCCTGGGGCTCTCTGG + Intronic
1034576718 7:152006126-152006148 CATGCCTCCCTGGGCCTCCAGGG - Intronic
1034888894 7:154822079-154822101 CCTCCTTCCCTGGGGCTCTGAGG + Intronic
1034917591 7:155053697-155053719 TCGGCCTCCCCGGGGCTCAGGGG + Intergenic
1035081476 7:156219841-156219863 CCTGCCCCTCTGGGCCTCTGAGG + Intergenic
1035132612 7:156669654-156669676 CTCGCATCCCCGGGGCTCTGAGG - Intronic
1035209042 7:157314227-157314249 CCTGCCTTCCTGGGGGCCAGAGG + Intergenic
1035238297 7:157514484-157514506 CCTGCAGCCCCTGGGCTCTGTGG + Intergenic
1035254631 7:157618496-157618518 CTGGCTTCCCTGTGGCTCTGTGG - Exonic
1035524377 8:300906-300928 GCTTCCTCCCTGGGGCTCAGTGG - Intergenic
1036145758 8:6253251-6253273 CCTGCCTCAGTAGGGCCCTGTGG - Intergenic
1036464045 8:8979686-8979708 CCTACCTCACTGGGTTTCTGTGG + Intergenic
1036547574 8:9786834-9786856 CCTGCCTCACTGTAGCTATGTGG - Intergenic
1036621558 8:10427573-10427595 CCTCACTCGCTGTGGCTCTGGGG - Intronic
1037240520 8:16772030-16772052 CCTGCCCCACAGAGGCTCTGAGG + Intergenic
1037581519 8:20248580-20248602 TCTGGCTTCCTGGCGCTCTGAGG + Exonic
1037754081 8:21700312-21700334 CCTGCCTCCCTGGGGCTCTGTGG - Intronic
1037855655 8:22368944-22368966 GGTGGCTCCATGGGGCTCTGGGG - Intronic
1038455435 8:27669522-27669544 CCTGCCTCCCGGCTTCTCTGAGG + Intronic
1038490348 8:27966107-27966129 TGGGCCTCCCTGGGCCTCTGGGG - Intronic
1039079464 8:33721361-33721383 CCTGCCTCCTGGGCACTCTGGGG + Intergenic
1039130794 8:34261975-34261997 CCTGCCTTCTTGGGGCTCATAGG - Intergenic
1040391354 8:46953401-46953423 CCTGACTCCTTGGCACTCTGGGG + Intergenic
1041242534 8:55860214-55860236 CCTGGCTACCTGGGGGGCTGAGG + Intergenic
1042005001 8:64169927-64169949 ACTCCCTCTTTGGGGCTCTGTGG + Intergenic
1042155661 8:65841809-65841831 CCCGCCGCCCTGGGGCTCCTCGG + Exonic
1042484194 8:69333481-69333503 CCTGCCTCATAGGGTCTCTGAGG + Intergenic
1042943910 8:74136082-74136104 CATGCCTCCCTGTGGAGCTGTGG + Intergenic
1044593745 8:93939115-93939137 CCTAGCTACCTGGGGCGCTGAGG - Intergenic
1046849043 8:118952173-118952195 GCTGTCTCCGCGGGGCTCTGAGG + Exonic
1048278552 8:133087425-133087447 CCTTCCTCCCTCGGGGTGTGAGG + Intronic
1049035416 8:140071646-140071668 CCTGCCCCACAGGGTCTCTGGGG + Intronic
1049056046 8:140238432-140238454 CCTGCTTCCCTGGAGCTCTCAGG - Intronic
1049229955 8:141476826-141476848 CCTGCCACCCTGGCCCTCTGCGG + Intergenic
1049243024 8:141548376-141548398 CCTCCCTCTCTGGGGCACGGAGG - Intergenic
1049425840 8:142537535-142537557 GCTGCCTCCCTGGCGCTCCCTGG + Intronic
1049454031 8:142677972-142677994 CCGACCTCCCTGGGACTCAGTGG - Intronic
1049476438 8:142799186-142799208 CCTGGCCCCCTGAGGGTCTGGGG - Intergenic
1049532445 8:143161021-143161043 TCCGCCTCCCCGGGGCACTGGGG + Intergenic
1049595393 8:143481069-143481091 ACACCCTCCCTGAGGCTCTGTGG + Intronic
1049621446 8:143600002-143600024 CCTGCCTCACTGGCACCCTGGGG + Exonic
1049690754 8:143957837-143957859 CCTGCCCTGCTGGGGCTCTCTGG + Intronic
1049758816 8:144322678-144322700 CCTCCCTGCCTGGGGGTCTTGGG - Intronic
1049762442 8:144337367-144337389 CCTGCCTCGCTCGGGGCCTGGGG + Intergenic
1049807764 8:144548599-144548621 CCTTCCTCGCTGGGGCCCTGTGG + Intronic
1050394405 9:5179835-5179857 CCTGCCTGACAGGGGCCCTGGGG + Intronic
1051363751 9:16305185-16305207 ACTGCCTACCTGGAGTTCTGGGG - Intergenic
1053135387 9:35647304-35647326 CCTGGGTCCCTGGACCTCTGAGG - Intergenic
1056661303 9:88545627-88545649 CCAGCCTCCTGGGGGCCCTGTGG + Intronic
1056831689 9:89922406-89922428 CCTGCCTCACTGGAGCTTGGTGG + Intergenic
1056958468 9:91101450-91101472 CAGGCTTCCCTGGGGCTCTGGGG - Intergenic
1057128536 9:92637892-92637914 ACAGCCTCCTGGGGGCTCTGGGG - Intronic
1057177699 9:93011531-93011553 CCTGTCTCACTGGGCATCTGTGG + Intronic
1057869362 9:98707264-98707286 CCTGGCTTCCTGGGACTCTCCGG - Intronic
1058636875 9:107046212-107046234 CCTGCCTTCTAGGTGCTCTGGGG - Intergenic
1058969278 9:110065129-110065151 CATGCCTCCATGGGGCTGTCAGG - Intronic
1059104908 9:111502446-111502468 ACACCCTCTCTGGGGCTCTGTGG + Intergenic
1059328327 9:113518254-113518276 CCTGGCTACCTGGGGCCATGGGG + Intronic
1059972070 9:119678347-119678369 CCTGCCTCCCTGGGATCCTGAGG - Intergenic
1060587293 9:124794570-124794592 CCAGCCACTCTGAGGCTCTGGGG + Intronic
1060881880 9:127123089-127123111 CCCGCCAGCCTGGGGCTCAGTGG - Intronic
1061060360 9:128247167-128247189 CCTGCCTCCTTGGGTCACTGAGG - Intronic
1061083714 9:128387111-128387133 TCTGCCTCCTTGTGGTTCTGGGG - Intronic
1061086830 9:128404561-128404583 CCTCCTTCTCTTGGGCTCTGGGG + Intergenic
1061260606 9:129478834-129478856 TCTGTCTCCCTGGGGGTCTGTGG + Intergenic
1061264471 9:129497272-129497294 CCCGTACCCCTGGGGCTCTGTGG + Intergenic
1061394111 9:130333927-130333949 CCTGCCTGCCTGTGGCTCCAAGG - Intronic
1061672162 9:132194797-132194819 CCTGGCTGCCTGGGGCTCCTCGG - Intronic
1061712545 9:132498116-132498138 CCTTACTCCCTGGGACTCTAGGG - Intronic
1061881432 9:133571119-133571141 CCTCCCACCCTGAGGCCCTGAGG + Intronic
1061907622 9:133706934-133706956 CCTGCCTGCCTGGGATTCTGAGG + Intronic
1061970473 9:134042090-134042112 CCCGCCTGCCTGGGGGGCTGTGG + Intronic
1062023779 9:134331170-134331192 CCTGCCTTCTTGGGACTCTGAGG - Intronic
1062066534 9:134530651-134530673 CATGCCTCCCTGCCACTCTGAGG - Intergenic
1062285839 9:135772107-135772129 CCTGCCTCCCCAGTGCCCTGCGG - Intronic
1062539433 9:137035050-137035072 CCTGACTCCCTGGGTTTGTGCGG + Exonic
1062579887 9:137224803-137224825 CCTGCCTCGCCGGGGCTTTGAGG + Exonic
1062594952 9:137295408-137295430 CCCGCCTCCCTGGGGCCGAGGGG + Intergenic
1062605771 9:137348284-137348306 CCTGGCTCTCTGAGGCTGTGAGG - Intronic
1062611198 9:137374383-137374405 GCAGCCTCCCTGGGCCTCTGGGG - Intronic
1062615824 9:137395258-137395280 CGAGTCTCCCTGGGGCTGTGGGG - Intronic
1062652531 9:137585598-137585620 CCTTCCTCACTGGGCCTCTCAGG - Intronic
1062652600 9:137585926-137585948 CCTGGCGCCCTGGGGCTTTTGGG - Intronic
1062707436 9:137953281-137953303 CCAGCCTCACTGGGGAGCTGAGG - Intronic
1203774672 EBV:66073-66095 CCTGCCTCCCGGAGGCTCTGCGG + Intergenic
1186201722 X:7162226-7162248 CCTGTGTCCCTGGGGCACTGGGG - Intergenic
1187669876 X:21657433-21657455 ACTGAGGCCCTGGGGCTCTGTGG - Exonic
1188027035 X:25220744-25220766 GCAGCCTCCCAGGGGCTCTTGGG - Intergenic
1188141798 X:26559186-26559208 CCTGCCTCCTGGGCACTCTGGGG - Intergenic
1188163687 X:26834507-26834529 GCAGCCTCCCGGGGGCTCTCAGG + Intergenic
1188801905 X:34542746-34542768 TCCCCCTCCCTGTGGCTCTGTGG - Intergenic
1189083676 X:37998371-37998393 ACTCCCTCTTTGGGGCTCTGTGG + Intronic
1189091903 X:38092423-38092445 GCAGCCTCCCAGGGGCTCTTGGG - Intronic
1189294185 X:39907322-39907344 CCTGCCTCCTGGGGCCTCTGTGG - Intergenic
1189488759 X:41453279-41453301 CCTGCCTCCTTGCAGCTCGGGGG + Intronic
1190055482 X:47178994-47179016 CTTTCCTTCCTGGGGCACTGCGG + Intronic
1192166720 X:68831221-68831243 CCTGCCTACCTTGGCCTCTTGGG + Intronic
1192426982 X:71085890-71085912 CCTGCCTCCATGAGGATATGAGG + Intergenic
1192510749 X:71719225-71719247 CCTGGCCCCGTGGGGCTCCGGGG - Intergenic
1192515948 X:71762328-71762350 CCTGGCCCCGTGGGGCTCCGGGG + Intergenic
1197653927 X:129095447-129095469 CTAGCCTCCCTGTGTCTCTGAGG + Intergenic
1199574110 X:149296915-149296937 CCTTCCTCTCTGGGCCTCTGTGG + Intergenic
1199599628 X:149534272-149534294 CCTGCTTCCCTGGGACTCGCCGG - Intergenic
1199618138 X:149675165-149675187 CCAGCCTGCCTGGGGCTCTGTGG + Intergenic
1199619595 X:149687274-149687296 CCAGCCTGCCTGGGGCTCTGTGG - Intergenic
1199624504 X:149728084-149728106 CCAGCCTGCCTGGGGCTCTGTGG - Intergenic
1199876004 X:151929085-151929107 CCAGCCTGCCTGGGGCTCTGTGG - Intergenic
1199893406 X:152110110-152110132 CCAGCCTGCCTGGGGCTCTGTGG + Intergenic
1199896408 X:152131384-152131406 GCAGCCTGCCTGGGGCTCTGTGG + Intergenic
1199950962 X:152706077-152706099 ACAGCCTGCCTGGGGCTCTGTGG - Intergenic
1199953261 X:152722691-152722713 CCAGCCTGCCTGGGTCTCAGTGG - Intergenic
1199956421 X:152745759-152745781 CCAGCCTGCCTGGGTCTCAGTGG + Intergenic
1199958720 X:152762384-152762406 ACAGCCTGCCTGGGGCTCTGTGG + Intergenic
1200019130 X:153187630-153187652 CCAGCCTGCCTGGGGCTCTGTGG - Intergenic
1200078126 X:153561943-153561965 CCTGGCACCCAGGGGCGCTGGGG + Intronic
1200159672 X:153999830-153999852 CTTTCCTCCCTGGTGATCTGAGG + Intergenic