ID: 1037755626

View in Genome Browser
Species Human (GRCh38)
Location 8:21708341-21708363
Sequence TCATTTGCTGGCTGCGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037755626_1037755633 -3 Left 1037755626 8:21708341-21708363 CCCCCTCCGCAGCCAGCAAATGA 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1037755633 8:21708361-21708383 TGAGAGAGAGTGCTATGAGAGGG No data
1037755626_1037755637 6 Left 1037755626 8:21708341-21708363 CCCCCTCCGCAGCCAGCAAATGA 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1037755637 8:21708370-21708392 GTGCTATGAGAGGGGAAGGTGGG No data
1037755626_1037755635 2 Left 1037755626 8:21708341-21708363 CCCCCTCCGCAGCCAGCAAATGA 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1037755635 8:21708366-21708388 GAGAGTGCTATGAGAGGGGAAGG No data
1037755626_1037755632 -4 Left 1037755626 8:21708341-21708363 CCCCCTCCGCAGCCAGCAAATGA 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1037755632 8:21708360-21708382 ATGAGAGAGAGTGCTATGAGAGG No data
1037755626_1037755634 -2 Left 1037755626 8:21708341-21708363 CCCCCTCCGCAGCCAGCAAATGA 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1037755634 8:21708362-21708384 GAGAGAGAGTGCTATGAGAGGGG No data
1037755626_1037755636 5 Left 1037755626 8:21708341-21708363 CCCCCTCCGCAGCCAGCAAATGA 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1037755636 8:21708369-21708391 AGTGCTATGAGAGGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037755626 Original CRISPR TCATTTGCTGGCTGCGGAGG GGG (reversed) Intronic
900738051 1:4311662-4311684 TCAATGGCTGCCTGCAGAGGAGG - Intergenic
900884312 1:5404373-5404395 GCATTTGCTGGCAGCTGTGGAGG - Intergenic
902370248 1:16002147-16002169 TCCCTTGCTGGCTTTGGAGGCGG - Intergenic
903265863 1:22157522-22157544 TCATCTGCTGGTTGGGGAGGAGG + Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
911644512 1:100323937-100323959 GCATAAGCTGGCTGCTGAGGCGG - Intergenic
911725352 1:101236702-101236724 TCATTTGTTGTTTGGGGAGGAGG + Intergenic
912818345 1:112848057-112848079 ACATTAGCTGGGTGCGGTGGTGG - Intergenic
915325017 1:155077348-155077370 TTATTTGCTGGCTCCTGAGAAGG + Intergenic
915909934 1:159908649-159908671 ACAGTAGCTGGGTGCGGAGGAGG + Intergenic
917052968 1:170945144-170945166 TACTTTGCTGGCTGCGGCTGAGG - Intronic
919018156 1:192067928-192067950 TCATTTGCTGGAAGAGGAGAGGG - Intergenic
922814709 1:228440155-228440177 TCATTTGCAGGCTGGGAGGGTGG + Intergenic
1069558644 10:69414230-69414252 ACATTTTCAGGCTGCTGAGGTGG - Intronic
1070512863 10:77177021-77177043 TTAGTTGCTGGCTGTGAAGGTGG + Intronic
1074279714 10:112039397-112039419 TGCTTTGCTGGCTGAGGAGCTGG - Intergenic
1074491176 10:113940979-113941001 ACATTTTCAGGCTCCGGAGGTGG - Intergenic
1075685839 10:124364653-124364675 TCATTTACTGGCTGAGCAGCAGG + Intergenic
1079121439 11:17688107-17688129 TAATTTACTGCCTGAGGAGGGGG - Intergenic
1079350861 11:19690799-19690821 TCATTTGCTGGATGGGGAACTGG + Intronic
1080648372 11:34203665-34203687 TCATTTCCTGTCTGTAGAGGGGG + Intronic
1084070843 11:66733344-66733366 TCAGTTGCTGGCAGTGGAGATGG + Intergenic
1086392074 11:86375287-86375309 TCATCTGCTTGCAGGGGAGGCGG + Intronic
1091225033 11:133951896-133951918 TCATTTTCTGGCTTTGGAGTAGG - Intronic
1094113770 12:26887904-26887926 TCATGTGCTGGCTGGGAATGAGG + Intergenic
1096020022 12:48316243-48316265 GCATTTGCTGGGAGTGGAGGGGG + Intergenic
1097106325 12:56628030-56628052 TAATTAGCTGGATGCGGTGGCGG + Intronic
1097183400 12:57183759-57183781 TCATTTTCTGGAGGTGGAGGAGG - Exonic
1098387298 12:69933195-69933217 GCCTTTGCGGGCTGCAGAGGCGG - Intronic
1101354738 12:103966211-103966233 TCCTTCCCTGGCTGCGGCGGTGG + Intronic
1104712322 12:130995584-130995606 GCAACTGCTGGCTGCAGAGGAGG - Intronic
1109966635 13:69707556-69707578 TCATTTACTTTCTGTGGAGGAGG - Intronic
1110501294 13:76231380-76231402 ACATTTACTGGCTTCAGAGGAGG + Intergenic
1115959593 14:38820311-38820333 CCATTTGCTAGCTGTGGAGTTGG - Intergenic
1117022710 14:51588185-51588207 TCATTTGCAGGTTTGGGAGGGGG - Intronic
1117591003 14:57268524-57268546 GCGTTTGCTGGCTGCCCAGGAGG - Intronic
1118221356 14:63857150-63857172 TCATTGGCTGGATGAGGAAGAGG - Intronic
1120532897 14:85655819-85655841 TCATTTGCTGACTTCTGATGGGG - Intergenic
1121555717 14:94835157-94835179 ATATTTGCTGACTGGGGAGGTGG - Intergenic
1121918644 14:97859553-97859575 TCCTTTGCTGGCTGCAGAAGGGG + Intergenic
1123954681 15:25323098-25323120 TCTTTTGCTGTCTGCACAGGTGG - Intergenic
1125334672 15:38615631-38615653 TCACTTTCTGGTTGCAGAGGAGG + Intergenic
1129267644 15:74402613-74402635 TCTTGTGGTGGCTGGGGAGGGGG + Intergenic
1129453638 15:75664389-75664411 TCAGGTTCTGGCTGTGGAGGAGG + Intergenic
1129608029 15:77034302-77034324 TCCTTTGCTGCCTGGGGAGCTGG + Intronic
1130025702 15:80268802-80268824 TCATTTGCTGACTCAGGAGCAGG + Intergenic
1131173117 15:90192237-90192259 TTGTTTGCTGGCTGTGGGGGAGG - Intronic
1131608621 15:93936769-93936791 TCATTTGCTGATTTTGGAGGGGG + Intergenic
1132566136 16:624270-624292 TCATTTGCTGCTGGGGGAGGTGG - Intronic
1132597910 16:761615-761637 CCATTTTCTGGCTGTGGGGGGGG + Intronic
1134837156 16:17370622-17370644 TCATGGGCTGACTGCAGAGGTGG + Intronic
1138510093 16:57503701-57503723 GGATTTGCTGCCTGCGGAGCGGG + Intergenic
1142733500 17:1879497-1879519 TCATTTGCTGGCGTCGGAATGGG + Intronic
1147502044 17:40974921-40974943 AAATTTGCTGGGTGCGGTGGCGG - Intergenic
1149690595 17:58572480-58572502 ACATTAGCTGGGTGCGGTGGCGG + Intronic
1151674119 17:75589184-75589206 TCCTGCGCTGGCTGCGGCGGCGG + Intergenic
1154193377 18:12248511-12248533 TAATTAGCTGGGTGCGGTGGGGG - Intergenic
1155392268 18:25350120-25350142 GCACTAGCTGGCTGCGGCGGGGG - Intronic
1157009376 18:43628072-43628094 TCATTTGCTGGCCTGGCAGGGGG - Intergenic
1157040977 18:44038461-44038483 TCATTTGGTCTCTGGGGAGGTGG - Intergenic
1158386915 18:57004565-57004587 TCATTTGATGGCTGCCCATGTGG + Intronic
1160400215 18:78605154-78605176 ACATGTCCTGGCTGCGGAAGAGG - Intergenic
1162333551 19:10045914-10045936 ACATTAGCTGGCTGTGGTGGTGG + Intergenic
1164243394 19:23409725-23409747 TTAGAGGCTGGCTGCGGAGGTGG - Intergenic
1164851750 19:31489897-31489919 TCATTTGCTGGGGGTGGAGGGGG + Intergenic
1166882798 19:45939643-45939665 TCAGTTCCGGGCTGGGGAGGGGG + Exonic
1168220106 19:54954378-54954400 TAATTAGCTGGGTGCGGTGGCGG + Intronic
925311239 2:2883755-2883777 CCATTGGCTGGGTGCGGTGGGGG - Intergenic
925540278 2:4959260-4959282 CCATCTGATGGCTGAGGAGGTGG + Intergenic
929890967 2:45918256-45918278 TCATGTGCTGGCTGTGGAAGGGG + Intronic
931305014 2:61020074-61020096 ACATTAGCTGGGTGCGGTGGCGG + Intronic
931434116 2:62232305-62232327 TGTTTTTCTGGCTGGGGAGGTGG + Intergenic
933166824 2:79085790-79085812 TTATTTGCTGGAAGAGGAGGAGG - Intronic
933760105 2:85667000-85667022 CCATTTCCAGGCTGAGGAGGAGG - Intronic
934925636 2:98380186-98380208 TCATCTTCTTGCTGCGCAGGTGG + Exonic
935637514 2:105261139-105261161 TAATGTGCTGGCTGCAGAGGCGG + Intergenic
935974046 2:108560007-108560029 TCATTTCCTGCCTGAGGAAGAGG + Intronic
938312444 2:130301929-130301951 GCGTTGGCAGGCTGCGGAGGTGG + Intergenic
942750738 2:179284076-179284098 TCCTTTGCGGGCTGTGGAGGAGG + Intergenic
943957235 2:194207871-194207893 TCAAGTGCTGGCTGTGGTGGGGG + Intergenic
944801331 2:203239944-203239966 ACATTAGCTGGCTGTGGTGGCGG + Intronic
946101954 2:217332957-217332979 TCTATTGCTGGCGGAGGAGGGGG + Intronic
946821413 2:223633747-223633769 TCATTTGCTGGCAGCGGCCTTGG - Intergenic
948853426 2:240719300-240719322 CCACTTTCTGGCTGGGGAGGTGG - Intronic
1169661433 20:7982562-7982584 ACAGTTGCAGGATGCGGAGGAGG - Exonic
1169768746 20:9178169-9178191 GCATTAGCTGGCTGTGGTGGCGG + Intronic
1172598772 20:36169074-36169096 AAATTAGCTGGCTGCGGTGGCGG + Intronic
1174016555 20:47493244-47493266 TCATTTGCAGGTTGTGGAGCAGG + Intergenic
1176240432 20:64073487-64073509 CCATTGGCTGCCTGGGGAGGAGG + Exonic
1176642394 21:9318257-9318279 AGATTTGCTGGCTGCTGAAGTGG - Intergenic
1180351407 22:11807611-11807633 AGATTTGCTGGCTGCTGAAGTGG - Intergenic
1180386795 22:12184466-12184488 AGATTTGCTGGCTGCTGAAGTGG + Intergenic
1180857951 22:19059976-19059998 TCATTCTGTGGCTGTGGAGGTGG - Intronic
1181689461 22:24550444-24550466 TCATGAGGTGGCTACGGAGGAGG - Intronic
1182625029 22:31639319-31639341 ACATTTGCTGGGTGTGGTGGCGG - Intronic
1184815809 22:46868894-46868916 TCATTTGCGGGGTGAGGTGGGGG + Intronic
949126439 3:450573-450595 TCATTTCCTTGTTGCAGAGGAGG + Intergenic
950306343 3:11917614-11917636 TCATTAGTTGGCTCCGGGGGTGG - Intergenic
950731561 3:14963919-14963941 TTATTTGCTGGGTGGGGAGGGGG - Intronic
952091308 3:29889867-29889889 TGACTTGATGGCTGGGGAGGAGG - Intronic
953738966 3:45520312-45520334 TCATTTGCTGGTAGCAGAGGAGG + Intronic
954906251 3:54065531-54065553 TGATTTGCTGGCTGTGGGGGTGG + Intergenic
955189061 3:56743460-56743482 TCACTTGCTGGCTGTGGACCTGG + Intronic
956203002 3:66727285-66727307 TCATTGGCTGGCTGAGCAGTAGG - Intergenic
956767085 3:72492808-72492830 TCATTAGGTGACTGAGGAGGGGG - Intergenic
956887569 3:73575708-73575730 TCATCTGATGGCTGCAGAGTTGG - Intronic
960289865 3:115870903-115870925 TCTTTTGCTTGCTGGGGAGATGG + Intronic
961951443 3:130753610-130753632 TGAGATGCTGGCTGCAGAGGAGG + Intergenic
964509964 3:157438940-157438962 ACTTTTGCTGGATGGGGAGGGGG + Intronic
965758618 3:172051454-172051476 TCATTTGATGGCTGGGTAGCTGG + Intronic
965927253 3:173996828-173996850 TTATTTTCTGGCAGGGGAGGTGG + Intronic
966257867 3:177939250-177939272 ACATTAGCTGGGTGCGGTGGTGG - Intergenic
967086374 3:186098444-186098466 AGATTTTCTGGCTGCAGAGGAGG + Intronic
1202744492 3_GL000221v1_random:86761-86783 AGATTTGCTGGCTGCTGAAGTGG + Intergenic
968586422 4:1418806-1418828 TAATTTGCTGGGTGAGGTGGAGG - Intergenic
969600878 4:8175625-8175647 CCATTTGCTGGCTACTGGGGAGG - Intergenic
970253884 4:14146681-14146703 TCATTTGCTTTCTGCCTAGGTGG + Intergenic
973258959 4:48141830-48141852 TAATTAGCTGGCTGTGGTGGTGG - Intronic
976188943 4:82470618-82470640 TGACTTGCTGCCTGTGGAGGAGG - Intergenic
976280939 4:83326435-83326457 TCATTTGCTGGATGAGGAACAGG + Intronic
977603842 4:98962211-98962233 ACATTTGCTGGGTGTGGTGGTGG + Intergenic
979942589 4:126780145-126780167 TCAGTTCCTGCCTGCGAAGGGGG + Intergenic
984407968 4:179357971-179357993 TTAGTTGCTGGCTGAGGATGGGG - Intergenic
986677104 5:10195699-10195721 TCATTTGGTGACTGGAGAGGTGG - Intergenic
989667696 5:43875041-43875063 GCATCTGCTGGCTGCTGAGAAGG + Intergenic
993947281 5:94130929-94130951 GCATTTGCTATCTGCAGAGGAGG - Intergenic
997651904 5:135528216-135528238 TCATATGCTGGCTATGCAGGAGG + Intergenic
998386485 5:141760133-141760155 TCATTTTATGGCTGCTCAGGTGG + Intergenic
1000361413 5:160451180-160451202 CCATTTGTTGGCTGCCGTGGGGG - Intergenic
1001240521 5:170066195-170066217 TCATTTGCGGGAGGCCGAGGTGG - Intronic
1005385168 6:25279006-25279028 CCATCTGCTGGCTGCGAGGGAGG - Intergenic
1005455010 6:26011434-26011456 TCATTGGCTGGGTGCAGTGGTGG + Intergenic
1007408931 6:41650374-41650396 TCAATTGATGGCTGATGAGGAGG - Intronic
1014437394 6:121436172-121436194 TCATTTGTTGGGTGGGGGGGGGG + Intronic
1020740990 7:12018116-12018138 ACATTAGCTGGGTGCGGTGGCGG - Intergenic
1022171648 7:27837489-27837511 ACATGTGCTGGGTGCTGAGGAGG + Intronic
1023750138 7:43364545-43364567 AGCTGTGCTGGCTGCGGAGGAGG + Intronic
1026869690 7:73842646-73842668 TCATTGGCTGGCGGGGGGGGGGG - Intergenic
1028439620 7:90844672-90844694 TCATTTGTTGACTGCAGAGAGGG - Intronic
1032619281 7:133511474-133511496 TCATTTGCTGGCACGGGAGTAGG + Intronic
1034591504 7:152143870-152143892 TACTTTGCTGGCTGCTGAGAGGG + Intronic
1037755626 8:21708341-21708363 TCATTTGCTGGCTGCGGAGGGGG - Intronic
1042340698 8:67675692-67675714 TCATTTGTGGACTGTGGAGGGGG + Intronic
1043308788 8:78832095-78832117 TCATTTGCTGATTTCTGAGGTGG - Intergenic
1044810533 8:96057099-96057121 TCTTTTGTTTGCTGTGGAGGGGG + Intergenic
1049536095 8:143183209-143183231 TCAGTCGGTGTCTGCGGAGGAGG + Intergenic
1054701613 9:68418718-68418740 TTATCAGCTGGCTGCGGCGGGGG + Intronic
1056153902 9:83816939-83816961 TCAATAGCTGGCGGGGGAGGAGG + Intronic
1056627772 9:88267894-88267916 TCCTTGGCTGGCTGAGGAGTGGG - Intergenic
1057050507 9:91920003-91920025 TTATGTGCTGGCTTCTGAGGGGG - Intronic
1061729649 9:132603888-132603910 TCATTAGCAGGGTGGGGAGGAGG + Intronic
1203713124 Un_KI270742v1:116710-116732 AGATTTGCTGGCTGCTGAAGTGG + Intergenic
1186642861 X:11474359-11474381 TCATTAGCTGGATATGGAGGTGG - Intronic
1191785819 X:64916567-64916589 TCAGTACCTGGCTGGGGAGGGGG - Exonic
1192006055 X:67213705-67213727 ACATTAGCTGGGTGCGGTGGTGG + Intergenic
1192033564 X:67541185-67541207 TCATTGGTTGCCTGAGGAGGAGG + Intergenic
1192312818 X:70030567-70030589 TTATTTGGAGGCTGGGGAGGAGG - Intronic
1194540317 X:95161938-95161960 AAATTAGCTGGCTGCGGTGGTGG - Intergenic
1195871717 X:109493362-109493384 TGATTTGATGGCAGTGGAGGTGG + Intergenic
1196700647 X:118664183-118664205 TGATTTGCTGGCTGTGGGAGGGG + Intronic
1197173563 X:123461217-123461239 TAATTTGCTGGCTGCCAAGAGGG + Intronic
1197371353 X:125629273-125629295 TCCTTTGTTGGCAGGGGAGGGGG + Intergenic
1201477854 Y:14403396-14403418 GCATTTGCAGGCTGCACAGGTGG - Intergenic