ID: 1037758484

View in Genome Browser
Species Human (GRCh38)
Location 8:21726685-21726707
Sequence AGGGTGGGCCCTAAATCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 2, 1: 18, 2: 30, 3: 90, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037758484 Original CRISPR AGGGTGGGCCCTAAATCCAG TGG (reversed) Intronic
900165207 1:1241746-1241768 GGGGTGGGGCCCAAATCCACAGG + Intergenic
900311166 1:2033805-2033827 AGGGTGGACCCTAAATCCGACGG - Intergenic
900535338 1:3174267-3174289 AGGGAGGGCCCTAATTCAATGGG - Intronic
900742579 1:4339722-4339744 AGGGTAGGCCCTGAACCCAATGG + Intergenic
900793831 1:4695749-4695771 AGGGTGGGCCCTAATCCAATAGG - Intronic
900881612 1:5385735-5385757 AGGGTGGGCCCTAACTCAATAGG - Intergenic
900893355 1:5465620-5465642 AGGGTGGGCCCGAATCCAAGAGG + Intergenic
901455503 1:9360719-9360741 GGGGTGGGCCCTGAATCCAATGG - Intronic
901863010 1:12086833-12086855 AGGATGGGGCCCTAATCCAGGGG - Intronic
902066501 1:13692541-13692563 AGGGTGGGCCTTAAATCTAATGG + Intergenic
902178156 1:14667023-14667045 AGGGTGGGCCTTAAATTCAACGG - Intronic
902694649 1:18132319-18132341 AGGGCTGACCATAAATCCAGGGG - Intronic
904539768 1:31224920-31224942 AGAGTGGGACCCAAAGCCAGCGG + Intronic
904844156 1:33396239-33396261 ATGGTGGGCCACAAATCCACAGG + Intronic
904955452 1:34279874-34279896 TTTGTGGGCCCTAAATCCAAAGG - Intergenic
905520460 1:38595440-38595462 CAAGTGGGCCCTAAATCCAGTGG + Intergenic
911058453 1:93727900-93727922 TGGGTGGGTCCTAAATCCAATGG + Intronic
911863292 1:102983421-102983443 TAGGTGGTCCCTAAATCCAATGG + Intronic
912630426 1:111242169-111242191 AGGGTGGCCCCTAAATGCCCAGG - Intronic
913176263 1:116275829-116275851 AGAGAGGGACCTAAATCCAATGG - Intergenic
913210748 1:116580349-116580371 GGGGTGGGCCCTAAATCCAGTGG + Intronic
913531697 1:119738304-119738326 GGGCTGGGCTCTCAATCCAGAGG - Intronic
915162624 1:153930896-153930918 AGGGTGGGTCCCATACCCAGAGG - Intronic
916680759 1:167103180-167103202 AGGATGGACTCTAAAGCCAGTGG - Intronic
917968262 1:180192025-180192047 AGGGTGGGCCCTAATCCAATAGG - Intronic
919940986 1:202286066-202286088 AGGGTGGGCCCCAAATCCAATGG - Intronic
919976261 1:202615020-202615042 AGGGTGGAGCATAACTCCAGAGG + Intronic
920196513 1:204230787-204230809 AGAGTGGGCCCTAAATCCAATGG + Intronic
921268898 1:213449525-213449547 AGGGTGGGACCTTAATCCCATGG - Intergenic
921618228 1:217297116-217297138 AATGTGGGCCCTAAATCCAATGG + Intergenic
923261640 1:232273539-232273561 AGAGTGGGCCCGAAATCCAATGG + Intergenic
923404352 1:233645396-233645418 CAGATGGGCCCTAAATCCAATGG + Intronic
1063072397 10:2679869-2679891 AGGGTGGGCCATGAGCCCAGGGG + Intergenic
1064983697 10:21189184-21189206 TGGGTGGGCCCTAAATCAAATGG + Intergenic
1067278037 10:44851763-44851785 AGGGTGGGCCTTAATTCAACAGG - Intergenic
1067306510 10:45069641-45069663 AGGATGGTCCTCAAATCCAGCGG + Intergenic
1069663583 10:70139829-70139851 GGGCTGGGCCCTGAATCCTGAGG + Exonic
1070307312 10:75247358-75247380 ACTGTGGGCCCTGAAACCAGAGG - Intergenic
1071853524 10:89599899-89599921 GGGGTGGGCCCTGAGTCCAATGG + Intronic
1072758031 10:98033503-98033525 AGGGTGGACCCTAATTCAATAGG + Intergenic
1072892437 10:99335929-99335951 AGGGTGGGCCCTAATCCAACAGG - Intronic
1075214788 10:120522967-120522989 AGGGTGAGCCCTAAGCCCAGTGG + Intronic
1075403123 10:122175164-122175186 AGGCTGGTCTCTAACTCCAGAGG + Intronic
1075832969 10:125427234-125427256 GGGATGGGGCCCAAATCCAGTGG - Intergenic
1076046623 10:127299408-127299430 AGGGTGGGCTCTTAATCCAATGG + Intronic
1076208017 10:128618726-128618748 AGGCTGGACCCTAAATCCAATGG - Intergenic
1076259471 10:129054339-129054361 TGGCTGGGCCCTAAATCCAAGGG - Intergenic
1076822167 10:132944822-132944844 AGGGTGGGCCCTAAACCCCATGG - Intergenic
1076901679 10:133341989-133342011 AGGGTGGACCCTAATTCAACAGG - Intronic
1077289963 11:1784496-1784518 AGGGTGGGCCCTAATCCCATAGG - Intergenic
1078005930 11:7532240-7532262 AGGGTGGGCCCTAATCCAATAGG - Intronic
1078506357 11:11951250-11951272 AGGGTGGGCCCTAATACAATAGG - Intronic
1078725375 11:13925649-13925671 AGGGTGGGCCAACAATTCAGAGG - Intergenic
1079410493 11:20182909-20182931 TTGGTGGGCCCTAAATCCAATGG - Intergenic
1079678143 11:23258813-23258835 AGAGTGGGGTCTAAATCCAGTGG + Intergenic
1079744727 11:24110549-24110571 AGGGTGGGCCGTAAATGTAGTGG - Intergenic
1079972995 11:27059200-27059222 AGGTTGGGCCATAGTTCCAGAGG + Intronic
1080295524 11:30722984-30723006 ATGGTGGGCCTTAAGTCCAGTGG + Intergenic
1083274270 11:61587962-61587984 AGGGTGGGGCCTCAATCCTGGGG - Intergenic
1084502640 11:69544011-69544033 GGGGTGGGCCCTAAATCCAATGG - Intergenic
1084652766 11:70498875-70498897 CGGGTGGGCCCTAAATCCAGTGG - Intronic
1086448556 11:86893028-86893050 AGAGTGGGGCCTAAATCCAATGG + Intronic
1088369024 11:109068172-109068194 AGGGTGACCCCTAAAAACAGGGG + Intergenic
1090773484 11:129943529-129943551 AGGGTGGGCCCTAATCCAACAGG + Intronic
1090965121 11:131591459-131591481 AGGCTGGGTCCTAAACCCAGTGG - Intronic
1091402399 12:188977-188999 AGGCTGTGCGCTAAAGCCAGGGG + Intergenic
1091854172 12:3725481-3725503 TGGGTGGGCCCTGAATTCAGTGG - Intronic
1092016278 12:5161424-5161446 ATGGTGGTCCCTCAATCAAGTGG + Intergenic
1093217899 12:16384354-16384376 AGATTGGGCTCTAAATCCAATGG + Intronic
1096111359 12:49031123-49031145 AGAGTGGGTCCTAGAGCCAGCGG - Intronic
1096932174 12:55224323-55224345 GGGGTGGATCCTAAATCCAATGG + Intergenic
1097394288 12:59054825-59054847 ACGGTGGGCCTTAAATCCAGTGG + Intergenic
1099410781 12:82323883-82323905 AGGGTGGGCCTTAAATCCAATGG + Intronic
1100324984 12:93532022-93532044 AGAGTGGGCCCTAAATCCAGTGG - Intergenic
1101022642 12:100568942-100568964 AGAGTGGACCCCAAATCCAACGG - Intergenic
1101855195 12:108436382-108436404 AGAGTAGGCCCTAAATCCAGTGG + Intergenic
1102889033 12:116543813-116543835 AGGACAGGCCTTAAATCCAGTGG - Intergenic
1103952213 12:124557497-124557519 AGGGTGGGCCCTAAATCCAGTGG - Intronic
1104389010 12:128375574-128375596 AGGGTGGGCCCTAAATCTAATGG - Intronic
1104421711 12:128641450-128641472 AGGGTGATCTCTAAATCCAATGG + Intronic
1104894801 12:132158884-132158906 AGGGTGGGCCATCAGTCCGGTGG + Intergenic
1105645230 13:22311197-22311219 AGGGTGGTCCCTAAAATCAATGG + Intergenic
1106330393 13:28734151-28734173 AGAGTGGGTCCTAATTCGAGAGG + Intergenic
1107410559 13:40154164-40154186 AGGGTGGGGCCCTAATCCAATGG - Intergenic
1107429477 13:40327305-40327327 AGGGTGGGCCCTAGTTTCACGGG - Intergenic
1108033443 13:46261349-46261371 AGGGTGAGCCCCAAATTCAATGG + Intronic
1108288932 13:48938089-48938111 AGGGTGGGTCCTAAATCCAAGGG - Intergenic
1108498330 13:51046067-51046089 AGGGTGGGCCCTAAATCCAAAGG + Intergenic
1110093979 13:71492327-71492349 AGGATGGACCCTAAATCCAATGG + Intronic
1112326528 13:98445740-98445762 AGGGTGGGCCCTAAATCCAACGG - Intronic
1112392511 13:98998288-98998310 AGGGTGGGTCCTACCTTCAGGGG - Intronic
1113776000 13:112945045-112945067 AGGGTGGGCCCTGAAGGGAGTGG + Intronic
1115453395 14:33574476-33574498 AGGCTGGGGCCAAAATGCAGTGG + Intronic
1116168411 14:41364716-41364738 AGGGTTGGCCCTAACTGAAGGGG + Intergenic
1116870539 14:50065655-50065677 AGGGCGGGCCCTAATCCAAGAGG - Intergenic
1117846015 14:59912695-59912717 AAGGTGGGCCCTAAATCCAATGG - Intergenic
1118316402 14:64728735-64728757 AGGGTGGGCCCCAAATCCAGTGG - Intronic
1118600074 14:67465817-67465839 CGGGTGGGCCCTACATGCAATGG + Intronic
1119432983 14:74580366-74580388 AGGGAGGACCCTAAATCCAATGG + Intronic
1119537032 14:75410872-75410894 AGGGTGGTCCCTTAATCTAGAGG - Intergenic
1119672668 14:76531273-76531295 TGGGTGGGCCCTACATCCAATGG - Intergenic
1120060255 14:79974375-79974397 AGGGTGGGCCACAAATTCAATGG - Intergenic
1120624182 14:86804002-86804024 AGGGTGGGCCCTAATCCAATAGG - Intergenic
1121267140 14:92611583-92611605 AGAGTGGGCCCTAAATCCAACGG - Intronic
1121662508 14:95646019-95646041 AGGTTGAGCCCTGAATCCAGCGG + Intergenic
1121863179 14:97338322-97338344 AGGGTGAGCTCTAAATCCAATGG - Intergenic
1122823134 14:104356997-104357019 TGGGTGGGCCTTAAATCCCACGG + Intergenic
1122874402 14:104656890-104656912 AGGGTGGGCCCTAATCCAACAGG + Intergenic
1124914633 15:33957901-33957923 AGTGTGGTCCCTGAACCCAGTGG + Intronic
1125321633 15:38494913-38494935 GGGGTGAGGGCTAAATCCAGGGG + Intronic
1126382491 15:48063657-48063679 AACGTGGGCTCTAAATCCAGTGG + Intergenic
1127699410 15:61483657-61483679 CAAGTGGGCCCTAAATCCAATGG + Intergenic
1128520170 15:68369927-68369949 TGGGTGGACCCTAAATTCAATGG + Intronic
1128911916 15:71523405-71523427 CAGGTGGGCCCTAAATCCAATGG - Intronic
1129279659 15:74474337-74474359 AGGGTGGGCTCAAACTCCTGGGG - Intergenic
1129952845 15:79607210-79607232 AGGGTTGGCTTTAAATCCAGGGG + Intergenic
1130612457 15:85373773-85373795 AGGGTGGTCCCTTAATCCTGAGG + Intergenic
1130863273 15:87909744-87909766 AGGGTGGGCCCTAATCCAATAGG + Intronic
1132615447 16:839256-839278 ACGGTGGGCCCTAAATCCAGTGG - Intergenic
1133037608 16:3042930-3042952 AGGGTGGGCCCTAAATTCAATGG - Intergenic
1133583332 16:7167348-7167370 AGAGTGGACCCTAAGTCCAGTGG + Intronic
1133612750 16:7448816-7448838 AAAGTGGGCCCTAAATCCAATGG - Intronic
1133709026 16:8383120-8383142 CAGGTGAGCACTAAATCCAGGGG + Intergenic
1133864816 16:9632781-9632803 AAGGTGGGACTTAACTCCAGAGG + Intergenic
1133884191 16:9810509-9810531 AGGGTGGGTCCTAACTCCAACGG + Intronic
1140035980 16:71371656-71371678 GGGGTGGGCCCTAAATCCAGTGG - Intronic
1140149442 16:72347424-72347446 AGGGTGGGCTCTAATTTCAGAGG - Intergenic
1141240331 16:82259925-82259947 TGAGTGGGCCCTAAATTCAATGG - Intergenic
1141811412 16:86378711-86378733 AGGGTGGGCCCTAAATCCAATGG - Intergenic
1142253133 16:89001951-89001973 AGGGTGGGCCCTAAATCCAACGG - Intergenic
1144114839 17:12077973-12077995 AGGGTGGGGCCCTAATCCACTGG - Intronic
1144272955 17:13636987-13637009 AAGGTGGGCCAGAAATCCAGCGG - Intergenic
1144878233 17:18414113-18414135 AGGGTGGGCTGTAAAGCCAATGG + Intergenic
1145153997 17:20530295-20530317 AGGGTGGGCTGTAAAGCCAATGG - Intergenic
1145219619 17:21077459-21077481 AGGATGGGCCCTAAATCCAATGG + Intergenic
1146571147 17:33954363-33954385 AGGGAGGGTCCTAAATCTACAGG - Intronic
1147861041 17:43523577-43523599 AGAGTGGGGCCTATATCCAGAGG + Intronic
1149340637 17:55682676-55682698 AGGTAGGGCCAGAAATCCAGAGG - Intergenic
1149520385 17:57314203-57314225 AGGGTGGGCCCTAATCCAATAGG - Intronic
1151385859 17:73754920-73754942 AGGGGGGACCCCAAATCCAGCGG + Intergenic
1151883900 17:76912105-76912127 AGGGTGGGCCCTAATCCAATAGG - Intronic
1151958264 17:77391498-77391520 TTAGTGGGCCCTAAATCCAATGG - Intronic
1152019299 17:77772082-77772104 AGGGAAGGCCCTGAATCCTGGGG - Intergenic
1152196650 17:78922484-78922506 AGGGTGGGCCCTAAATCCAATGG + Intronic
1152227142 17:79097725-79097747 AGGCTGGAAGCTAAATCCAGTGG - Exonic
1152554095 17:81044467-81044489 AGGGCGGGCCCTAATCCCATAGG - Intronic
1152859320 17:82686459-82686481 TAGGTGGGCCCTAAATCCAATGG + Intronic
1153910312 18:9700993-9701015 AAGGTGGGCCTTGAAGCCAGGGG - Intergenic
1155162769 18:23208972-23208994 AGAGTGGGCCTTCAATCCAATGG - Intronic
1155361418 18:25006925-25006947 AGGGTGGGCCCTAATCCTACAGG + Intergenic
1155426106 18:25709198-25709220 TGGGTGGACCCTAAATCTAATGG - Intergenic
1156422710 18:36972699-36972721 AGGGTGTCCCCTATATCCAGCGG + Intronic
1156712616 18:39965035-39965057 AGATTTGGCCCTAAATCCAATGG - Intergenic
1156917104 18:42474520-42474542 AGGGTGGAGCCTAAATTCAATGG - Intergenic
1158185043 18:54761961-54761983 AGGATGGGCTCCAAATCCAGTGG + Intronic
1159473843 18:68891781-68891803 AGGGTGGGGCCTTAATCCAATGG - Intronic
1159649892 18:70965668-70965690 AAGGCTGGCCCTAAGTCCAGAGG - Intergenic
1159913570 18:74168907-74168929 GGGGTGGGCCCTAAATTCAAGGG - Intergenic
1160287644 18:77559758-77559780 AGGGTGGGCCTTAAATCCAATGG - Intergenic
1160391888 18:78540299-78540321 AGGGTGGACCCTAAATCCAATGG + Intergenic
1160688445 19:448483-448505 AGGGTGGGGCCTAAATGCAATGG - Intronic
1163415410 19:17183484-17183506 AGGGTGGGACGTGCATCCAGCGG - Intronic
1163585180 19:18160065-18160087 AGGGTGGACACTAAACCCACTGG - Intronic
1164531168 19:29049275-29049297 AGGGTGGGCCCAAAATCCAATGG - Intergenic
1167642753 19:50690845-50690867 GGGGTGGTACCTAAATACAGTGG - Intronic
1167651471 19:50732210-50732232 AGGGTGGGCCCTAATCCAATTGG - Intergenic
925056173 2:858905-858927 AGGGTGGGCCCCAATCCCACAGG - Intergenic
925302143 2:2824865-2824887 AGGGTGGGCCCTGATCCCATAGG - Intergenic
925719598 2:6814088-6814110 AGGGTGGGTGCTAAATCCAATGG - Intergenic
926820942 2:16851175-16851197 AGGGTGGGCCCTAAATACAATGG + Intergenic
928291526 2:30041980-30042002 TGGGTCGACCCTAAGTCCAGAGG + Intergenic
928703874 2:33926876-33926898 AAAGTGGGCCCTAAATCCAGTGG + Intergenic
929431911 2:41894239-41894261 AGGGTGGGCCCTAATCCAATAGG + Intergenic
930132880 2:47870442-47870464 AGGGTGGGGCCTAATTCAATAGG + Intronic
930535695 2:52643545-52643567 TGGGTGAACCCTTAATCCAGTGG - Intergenic
932312010 2:70750442-70750464 AGGGTAGGTCCTAAATCCAATGG + Intronic
934052435 2:88221824-88221846 AGAGTGGGCCCTAATCCCATAGG - Intergenic
935322448 2:101902209-101902231 AGGGTGGGCCCTAATCCAATAGG + Intergenic
937811048 2:126199469-126199491 AGAGTGGGCAATAAATGCAGAGG - Intergenic
938382379 2:130843842-130843864 CAGGGGGGCCCTGAATCCAGAGG + Intronic
939117391 2:138076073-138076095 AGGATGGGCCCCTGATCCAGTGG - Intergenic
940129330 2:150363240-150363262 AGGGTGGGCCCTAATTCAATAGG + Intergenic
940178322 2:150904045-150904067 AGGGTGCCCCCTACACCCAGGGG + Intergenic
941645094 2:168031594-168031616 AGGGTGGGCCCTAATCCAACAGG + Intronic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
942602286 2:177653572-177653594 AGAATGGGCCCTAAATCCAATGG + Intronic
943452338 2:188059130-188059152 TGGCTGGGCCATAAATCCAATGG + Intergenic
944438788 2:199720670-199720692 ATGTTGGGCCCTAAATCCAACGG - Intergenic
944874656 2:203950172-203950194 AGGCTGGGGCCTAAGTCTAGGGG + Intronic
946409243 2:219508204-219508226 AGGGTGGGCCATAGGACCAGGGG + Intergenic
947392729 2:229655767-229655789 TGGGTGGGTCCTAAATGCAATGG + Intronic
948147954 2:235722609-235722631 AGGATGGGCCCTAAATCCAATGG - Intronic
948761732 2:240196628-240196650 AGGGTGGTCCCTAGATCCAATGG + Intergenic
948771515 2:240253510-240253532 AAGGTGGACCCTAAATCCAATGG - Intergenic
1168787382 20:551685-551707 AGAGTGGGCCCTAATTCAACAGG + Intergenic
1170658068 20:18309137-18309159 AGGGTGGGCCCTAATCCAATGGG - Intronic
1170879252 20:20280146-20280168 AAGGTTGGCCCTAAATCCAATGG + Intronic
1172303641 20:33866379-33866401 CTAGTGGGCCCTAAATCCAATGG - Intergenic
1173058561 20:39639734-39639756 TAGGGTGGCCCTAAATCCAGTGG + Intergenic
1174408915 20:50321237-50321259 ACCCTGGGCCCCAAATCCAGCGG - Intergenic
1175311098 20:58012035-58012057 AGGGTGGGCTCTGAGTCCAATGG + Intergenic
1175390052 20:58621402-58621424 GGGGACGGCCCTAAATCCAATGG + Intergenic
1175849968 20:62085002-62085024 AGAGTGGGCCCTAAATCCAGTGG + Intergenic
1176300631 21:5097344-5097366 TGCGTGGGCCCTGAGTCCAGTGG - Intergenic
1178120033 21:29460334-29460356 TGAGTGGGCCCTAAATCCAATGG + Intronic
1178877831 21:36426316-36426338 AGGGTGGACTCTAAAGCCAATGG - Intergenic
1179165420 21:38931844-38931866 AGGGTGTGCTTTAAATCCAAAGG + Intergenic
1179267271 21:39814826-39814848 AGGGTGGGGCCTTAAGCCAATGG + Intergenic
1179283268 21:39953130-39953152 TGGGTAGGCCCTAAATCCAATGG + Intergenic
1180123006 21:45766373-45766395 AGGGTGGGCCCGAATTTGAGAGG + Intronic
1180715013 22:17865786-17865808 GGGGAGGGCCCGAAATGCAGTGG - Intronic
1180997911 22:19974583-19974605 AGGGTGGGCCCTATTACCAGGGG - Intronic
1182051679 22:27317171-27317193 AGGCTGGGCCCTAAATCAAATGG + Intergenic
1182670774 22:31993998-31994020 AGGATGGGCCCTAAATCCAATGG - Intergenic
1184582456 22:45426728-45426750 AGTGTCTGCCCTCAATCCAGGGG - Intronic
1184874209 22:47262754-47262776 AGGGTGGGACCAGAGTCCAGTGG + Intergenic
949948909 3:9213046-9213068 AAGTGGGGCCCCAAATCCAGGGG - Intronic
952213077 3:31249014-31249036 AGGGTGGACTCTAAATCCAATGG + Intergenic
954687754 3:52379807-52379829 AGGGTGGGCCCCAGTTCCTGGGG - Intronic
955319973 3:57967393-57967415 AGCATGGGCCCTAAATCCAATGG - Intergenic
955977996 3:64496722-64496744 TGGGTAGGACCCAAATCCAGTGG + Intergenic
956681836 3:71788257-71788279 AGGGTGGGTTCTAAATTCAATGG + Intergenic
959087254 3:101864510-101864532 CAGGTGGCCCCTAAATTCAGTGG - Intergenic
960279897 3:115769419-115769441 ATGGTGGGCCGCAAATTCAGTGG - Intergenic
960947260 3:122975176-122975198 AGGGTGGGCCCTGGGTCCAGGGG + Intronic
964621097 3:158720830-158720852 AGAATGGGCCCTAAATCCAATGG - Intronic
966544135 3:181125646-181125668 TGGGTGGGCCCTAAATGTGGTGG - Intergenic
968813263 4:2809419-2809441 AGGGAGGGCACTGAGTCCAGGGG - Intronic
969119903 4:4900463-4900485 CAGGTGGGCCCTGAATCCAATGG - Intergenic
969186247 4:5476809-5476831 AGGGTAGGCACTAAATCCAATGG + Intronic
969220941 4:5758042-5758064 CGGGTGGGCCCTAATTCTAATGG + Intronic
969349185 4:6588371-6588393 AGGGTGGGCCCTAATACAATAGG - Intronic
969450383 4:7269508-7269530 AGGGTGGGCCCTAAATCCAATGG + Intronic
969502681 4:7562887-7562909 AGGCTAGACCCTAAATCCAATGG - Intronic
969642324 4:8406292-8406314 CAGGTGGGCCCTAAATCCCACGG + Intronic
969662959 4:8540986-8541008 CAAGTGAGCCCTAAATCCAGTGG - Intergenic
970299901 4:14670160-14670182 AGGATGGGCCCAACATACAGAGG - Intergenic
971046538 4:22811267-22811289 ACAGTGTGCCCTAAATCCAATGG - Intergenic
972314021 4:37908599-37908621 AGAGTGGACACCAAATCCAGAGG - Intronic
972387015 4:38577043-38577065 AGAGTGGGCCCTAAATCAAATGG + Intergenic
974523526 4:63017810-63017832 AGACTGGGCCCTAATTCCAACGG + Intergenic
976061700 4:81136351-81136373 ATGCTGGGCCCTAATGCCAGAGG - Intronic
977638031 4:99323097-99323119 AGAATGGGCCCTAAAACCACAGG - Intergenic
979724991 4:123950476-123950498 AGGGTGGTGCCTACATCAAGGGG - Intergenic
982164675 4:152603977-152603999 CAGGTGGACCCTAAATCCAAAGG + Intergenic
982229439 4:153195099-153195121 AGGGTGGGCCTTAAATCCAATGG + Intronic
985185019 4:187305180-187305202 AGGGTAGGCCCTAGGTCCACTGG - Intergenic
985899890 5:2780221-2780243 AGGGTGGGCTCTAATCCCATGGG - Intergenic
985913166 5:2898395-2898417 CAGGTGAGCCCTAAATCCAAGGG - Intergenic
986076539 5:4343834-4343856 AGGGTCAGCCCTAAATCCAACGG + Intergenic
986723521 5:10577460-10577482 AGGATGGGCCCCGACTCCAGGGG - Intronic
987185354 5:15411879-15411901 CAGGTGGGCCCTAAACCCAACGG - Intergenic
987260170 5:16195226-16195248 AGGAAGGGGGCTAAATCCAGGGG + Intergenic
988014705 5:25539447-25539469 AGGGTGGAACCTAAATTCAATGG + Intergenic
989094215 5:37766323-37766345 AAGGTGGGTCCTAAATCCAATGG + Intergenic
990160806 5:52937972-52937994 AGGGTGGACCCTAAATCTAATGG - Intronic
993478183 5:88390291-88390313 AGGGTGGGGCTGAAATGCAGGGG + Intergenic
995138846 5:108710527-108710549 TGGGTGGACCCCAAATCCAATGG - Intergenic
995152795 5:108869508-108869530 AGAGTAGGCCCTAAATCCAATGG + Intronic
997070529 5:130617406-130617428 AGGGTGGGACTTGACTCCAGAGG + Intergenic
997631718 5:135373796-135373818 AGGGTGGGCCCTCAGCCCTGTGG + Intronic
997690109 5:135822599-135822621 AGGGTGGGCCCTAAATCCAATGG - Intergenic
998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG + Intergenic
998355556 5:141532553-141532575 AGGGAGGGATCTAAATCAAGTGG - Intronic
998537988 5:142952100-142952122 TGAGTGGGCCATAAATCCAATGG - Intronic
999452000 5:151685605-151685627 AGATGGGGCACTAAATCCAGGGG + Intronic
999522881 5:152370550-152370572 TGGGTAGTCCCTAAATCCAATGG + Intergenic
1000050152 5:157555970-157555992 TGGATGGGCCCTAAATACAATGG - Intronic
1000821925 5:165995425-165995447 AAGGTGGACACTAAATCCAGGGG + Intergenic
1001272045 5:170320195-170320217 AGGCTGGGCCCTTACTCCAATGG - Intergenic
1006639513 6:35482549-35482571 ATGGTGGACCCTGAATTCAGGGG + Intronic
1008383910 6:50865418-50865440 AGGGTGGGCCCTAAACTCAGTGG + Intergenic
1008844490 6:55946617-55946639 AGAGTGGGCCCTAAATCCAATGG - Intergenic
1010615887 6:78011874-78011896 AGAGTAGGCCCTATATCCAATGG + Intergenic
1011717547 6:90123137-90123159 TGAGTAGGCCCTAAATCCAAGGG + Intronic
1013297076 6:108767179-108767201 AGGGTGGGGAAGAAATCCAGAGG + Intergenic
1014317437 6:119884854-119884876 AGGGTGGGCCCTAATCCAATAGG + Intergenic
1017129154 6:151093320-151093342 AGGGTGGGCCCTAATCCAATAGG - Intronic
1017606022 6:156134100-156134122 AGAGGGGGCCCTAAATCCAATGG + Intergenic
1019414554 7:921246-921268 AGGGTGGGCCCAAACCCCACAGG - Intronic
1020706787 7:11554240-11554262 AAGGTGAGCCCTAAATCCAATGG + Intronic
1022342779 7:29484603-29484625 AGTATGGGCCCTAAATCCCATGG - Intronic
1022456649 7:30563938-30563960 AGGGTGGACTCTGAACCCAGTGG - Intergenic
1023902503 7:44493630-44493652 AGGGTGGGACCTTAACCCAATGG + Intergenic
1024415423 7:49099696-49099718 AGGGATGGCCCTAAATGAAGTGG - Intergenic
1026411639 7:70128951-70128973 AGGATGGGCTGTAAATCCAATGG - Intronic
1030088003 7:105833377-105833399 AGGCTCTGCCCTAAATACAGGGG - Intronic
1030104256 7:105973594-105973616 AGGGTGGGTCCTAAATCCAGTGG - Intronic
1031939677 7:127775022-127775044 AGAATGGGCCCTAAATCCAGTGG + Intronic
1035528396 8:332694-332716 TGGTTGGGCCCTAAATCCAATGG + Intergenic
1036114432 8:5943458-5943480 AGGGTGGGCCCTAACCCAACTGG - Intergenic
1036461192 8:8954330-8954352 TAGGTGGGCTCTAAATCCATTGG - Intergenic
1036702052 8:11019395-11019417 TGGGTGGTCCCGAAGTCCAGAGG - Intronic
1036927399 8:12920423-12920445 AGGGTAGTCTCAAAATCCAGGGG - Intergenic
1037026318 8:14042720-14042742 AGGGTGAGCCCTGAATCCATAGG + Intergenic
1037758484 8:21726685-21726707 AGGGTGGGCCCTAAATCCAGTGG - Intronic
1038285200 8:26200264-26200286 AGGGTGGGCCCTAATCCAACAGG + Intergenic
1038530168 8:28312057-28312079 AGGGTGGGCCCTAATCCAATAGG + Intergenic
1039449239 8:37658454-37658476 GGGTGGGGCCCTAAATCCAATGG - Intergenic
1039827787 8:41189570-41189592 AGGGTGGGCCCTAAATCCAAAGG - Intergenic
1039863116 8:41476763-41476785 AGGGTGGGCCCTAAACCAGTGGG - Intergenic
1040870761 8:52098333-52098355 AGGGTGGGCCCTAATCCCATAGG + Intergenic
1041179749 8:55235239-55235261 AGGGTGGGCCCTAAATCCAATGG - Intronic
1041802457 8:61814590-61814612 AGGGTGGACCGTAAATCCAATGG + Intergenic
1042640871 8:70932771-70932793 AGGGTGGGCCCTAATCCAAAGGG - Intergenic
1042648631 8:71014556-71014578 TAGGTGGCCCCTAAATCCAATGG - Intergenic
1043091798 8:75913676-75913698 TGGGTGATCACTAAATCCAGTGG - Intergenic
1044308062 8:90660257-90660279 CAGGTGAGCCCTAAATCCAATGG + Intronic
1046189426 8:110772746-110772768 AGGGTGGGCCCTAATTCAATAGG + Intergenic
1046311904 8:112448387-112448409 AGGGTGAGCCCTAAATCCAATGG + Intronic
1046528713 8:115415622-115415644 AGGGTGGGGCCCTAATCCAATGG + Intronic
1047212287 8:122849650-122849672 CTGATGGGCCCTAAATCCAATGG - Intronic
1047761094 8:127955129-127955151 AGGGTGGGCCCTAAGCCAACTGG + Intergenic
1048133637 8:131724513-131724535 AGGGTGTGTCCTAAATCCAATGG + Intergenic
1048259183 8:132931228-132931250 AGGGTGGGCCCTAAGGCAATAGG - Intronic
1049157939 8:141078335-141078357 AGGGTGGGCCCCAAACCCAGTGG - Intergenic
1049317403 8:141976673-141976695 AAGGTGGGTCCTAAATCCAGTGG + Intergenic
1049804074 8:144531015-144531037 AGGCTGGGCCCTGACCCCAGAGG + Intronic
1050204667 9:3183818-3183840 TGGATGGGCCCTAAATCCAATGG - Intergenic
1050647093 9:7731899-7731921 AGGGTGGGGCCTAAATTCAATGG + Intergenic
1052536884 9:29759307-29759329 AGGTTGGGCCCTAAAGCTACAGG - Intergenic
1055661519 9:78508409-78508431 AGGGTGGGGCCTTGATCCATAGG + Intergenic
1056324756 9:85466950-85466972 AGGATGGGCCGTAAACCCAATGG + Intergenic
1058703584 9:107620793-107620815 TGGGTGGACCCAAAAGCCAGGGG - Intergenic
1059553171 9:115250872-115250894 AGAGTGGGCCCCAAACACAGGGG + Intronic
1060667540 9:125441261-125441283 TGGGTGGTCCCTAATTCCACAGG - Intronic
1061299709 9:129697604-129697626 GGGGTCGGTCCGAAATCCAGGGG - Intronic
1061916722 9:133759443-133759465 AGGGTAGGCCCTAATCCAAGAGG + Intergenic
1062220078 9:135410309-135410331 TGGGTGGGCCCTAATCCCACAGG + Intergenic
1185484889 X:474737-474759 AGGCTGGGCCCTAAATGCAATGG - Intergenic
1185523902 X:762056-762078 AGGATGGGCCCTAAATGCAATGG - Intergenic
1185536819 X:869054-869076 AGGGTGGGTCCTAAATGCAATGG - Intergenic
1185557929 X:1036056-1036078 AGGGTGGGCCCTGATTCAATGGG + Intergenic
1185614758 X:1414057-1414079 AGGGTGGGCCCTAAATGCAATGG + Intronic
1185677350 X:1859636-1859658 AGGGTGGGCTCTAAATGCAATGG - Intergenic
1185776365 X:2805762-2805784 AGGGTGGGCCCTAATCCAATAGG - Intronic
1185779948 X:2835540-2835562 TGGGTGGGCCCTAAATCCAATGG + Intronic
1185822757 X:3220519-3220541 AGGGTGAGCCCTAAACCCAATGG - Intergenic
1185838771 X:3369378-3369400 AGGTTGGGCCCTAAATGCAATGG - Intergenic
1185923916 X:4125314-4125336 AGGGTAGACCCTAAATGCAATGG + Intergenic
1185933342 X:4228089-4228111 AGGGTTGGCTCTAAATCCAACGG - Intergenic
1186042438 X:5495742-5495764 AGGGTGGGCCCTAATCCAATAGG + Intergenic
1186120865 X:6359609-6359631 AGAGTGGGCCCTAATTCAACAGG + Intergenic
1186198292 X:7131428-7131450 CCGGTGGGCCCTACATCCAATGG + Intronic
1186513193 X:10146621-10146643 CGGGTAGGCCCTAAATCCAATGG - Intergenic
1186865611 X:13717905-13717927 AGGGTGGGCCCCTAATCCAATGG + Intronic
1188981677 X:36732574-36732596 TGAGTGAGCCCTAAATCCAATGG + Intergenic
1189739839 X:44106367-44106389 TGGGTGGGCCCTAAATCCAATGG + Intergenic
1193569974 X:83129141-83129163 AGCTTGGGCCCAAAATGCAGTGG + Intergenic
1194002951 X:88454578-88454600 ATGGTGGGCTCTTAATCCAATGG + Intergenic
1195009090 X:100717704-100717726 AGGCTGTGGCATAAATCCAGGGG + Intronic
1195278231 X:103303620-103303642 AGTGTGGGTCCTAAATCCAATGG + Intergenic
1196067494 X:111481120-111481142 TGTGAGGGCCCTACATCCAGTGG + Intergenic
1199665342 X:150092234-150092256 AGGGTGGGCCCTAAATCCAATGG + Intergenic
1199676926 X:150196866-150196888 CAGGTAGGCCCTAAATCCAATGG + Intergenic
1199948935 X:152690054-152690076 AGGCTGTGCCCTACTTCCAGTGG + Intergenic
1199960741 X:152778395-152778417 AGGCTGTGCCCTACTTCCAGTGG - Intergenic
1201290102 Y:12414449-12414471 TGGGTGGGCCCTAAATCCAATGG - Intergenic
1201598015 Y:15693962-15693984 AGGGTGGACCCTGAATCAATAGG + Intergenic
1201647625 Y:16252914-16252936 AGGGTGGGTCCTAATCCCATAGG - Intergenic
1201655186 Y:16332387-16332409 AGGGTGGGTCCTAATCCCATAGG + Intergenic