ID: 1037762497

View in Genome Browser
Species Human (GRCh38)
Location 8:21751160-21751182
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037762489_1037762497 28 Left 1037762489 8:21751109-21751131 CCTAAAGCTGTGGTGAGGAGTAA 0: 1
1: 0
2: 3
3: 38
4: 250
Right 1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr