ID: 1037762497 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:21751160-21751182 |
| Sequence | CTTAGGAAGCAGCTGGTGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037762489_1037762497 | 28 | Left | 1037762489 | 8:21751109-21751131 | CCTAAAGCTGTGGTGAGGAGTAA | 0: 1 1: 0 2: 3 3: 38 4: 250 |
||
| Right | 1037762497 | 8:21751160-21751182 | CTTAGGAAGCAGCTGGTGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037762497 | Original CRISPR | CTTAGGAAGCAGCTGGTGCA GGG | Intronic | ||
| No off target data available for this crispr | |||||