ID: 1037762950

View in Genome Browser
Species Human (GRCh38)
Location 8:21754108-21754130
Sequence GGGAAAAATAGGTCGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037762950_1037762956 3 Left 1037762950 8:21754108-21754130 CCCTACTCCGACCTATTTTTCCC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1037762956 8:21754134-21754156 GCACTCATCACTATCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037762950 Original CRISPR GGGAAAAATAGGTCGGAGTA GGG (reversed) Intronic
900763516 1:4488457-4488479 GGGAAAAATAGAGGGGAGTGGGG + Intergenic
909611267 1:77554117-77554139 TGGAAAAATAGGTTGGAATGAGG - Intronic
910616953 1:89208954-89208976 GGGAAAAATAAGTGGGAGATGGG - Intergenic
910849025 1:91632954-91632976 GGGAGAGAGAGGTGGGAGTATGG - Intergenic
911906542 1:103576084-103576106 GAGAAAAATATTTGGGAGTATGG + Intronic
911910048 1:103622456-103622478 GAGAAAAATATTTGGGAGTATGG + Intronic
911913146 1:103661233-103661255 GAGAAAAATATTTGGGAGTATGG + Intronic
911915308 1:103690715-103690737 GAGAAAAATATTTGGGAGTATGG - Intronic
911917464 1:103716581-103716603 GAGAAAAATATTTGGGAGTATGG + Intronic
911920559 1:103755371-103755393 GAGAAAAATATTTGGGAGTATGG + Intronic
912422148 1:109550021-109550043 GAGAAGAATAAGTAGGAGTAGGG + Intronic
913312211 1:117511756-117511778 GGGAAAAGTAAGAGGGAGTAAGG - Intronic
914951812 1:152122341-152122363 GGGCAAAACAGGTGGGAGTGAGG + Intergenic
915749903 1:158196881-158196903 GGTAAAATTAAGTTGGAGTATGG + Intergenic
919913678 1:202127417-202127439 GGGAAACTTAGGTAGGAGGATGG - Intronic
920547692 1:206832103-206832125 GGGAAACAAGGGTGGGAGTAGGG + Intronic
1063963381 10:11325806-11325828 GGAAAAAAAAAGTCAGAGTAAGG - Intronic
1067516363 10:46949116-46949138 GGGAGAAATAGGTCTAAGTGGGG + Intronic
1067645886 10:48102677-48102699 GGGAGAAATAGGTCTAAGTGGGG - Intergenic
1068384037 10:56299870-56299892 GGGTAAAATAGGTAGGGTTAAGG + Intergenic
1068855876 10:61796723-61796745 GTGAAAAATACATCAGAGTAAGG - Intergenic
1069106299 10:64386974-64386996 GGGAAACTGAGGTGGGAGTATGG - Intergenic
1072880509 10:99222493-99222515 AGGAAGAATAAGTCAGAGTATGG + Intronic
1076546973 10:131251876-131251898 AGGTAAAATAGTTCGGAGTGTGG - Intronic
1077283981 11:1757832-1757854 GGGAGTAAGAGGTCGGAGCAGGG - Intronic
1079056109 11:17207899-17207921 GGGAAAAATGGCTCGGACTGTGG - Intronic
1080018557 11:27533937-27533959 GAGAAAAATAAGTTAGAGTAAGG + Intergenic
1080530256 11:33168005-33168027 AGCAAAAATAGGCCGGGGTAGGG - Intergenic
1080790341 11:35516954-35516976 GGAAAAAAGAGGTGGGAGAAGGG + Intronic
1081748889 11:45493699-45493721 GGAAAAAATAGATCAGAATAAGG - Intergenic
1090419741 11:126566276-126566298 AGGAAAAATGGATTGGAGTAGGG + Intronic
1091558276 12:1592635-1592657 GGGAAAAGGAGCTGGGAGTAGGG + Intronic
1091926520 12:4355758-4355780 GAGCAAAATAGGTCAGAGTAAGG + Intergenic
1094131788 12:27082537-27082559 AGAAAAAATAGGTGGGACTAAGG + Intergenic
1097241275 12:57576974-57576996 GGGAAAAATATGATGGGGTAGGG + Intronic
1097326868 12:58287365-58287387 GGGGAAAATAGGTCAGGGTGAGG - Intergenic
1099120498 12:78683957-78683979 GGAAATAATAGCTCTGAGTACGG + Intergenic
1101573184 12:105973926-105973948 GGGAAAAATTGGTGGGGGTGTGG + Intergenic
1101718822 12:107333836-107333858 GGAAAAAATAAATCAGAGTAAGG + Intronic
1105662760 13:22516903-22516925 GGGAAAAGGAGGTCGGGGAAAGG - Intergenic
1108564961 13:51687379-51687401 GGGAGAAATAGAACAGAGTAAGG + Intronic
1114628865 14:24146906-24146928 GGGTAAGAGAGGTGGGAGTATGG + Exonic
1121526896 14:94625460-94625482 GGGCAAAATAGGTCAGAGCTGGG + Intergenic
1124826157 15:33097620-33097642 GGGAAAAATAGTGGGGAGGAGGG + Intronic
1126471483 15:49016213-49016235 GGGAAAAGCAGGTAGTAGTAAGG + Intronic
1127025204 15:54797457-54797479 GGAAAAAACAGATTGGAGTAAGG - Intergenic
1127688583 15:61372490-61372512 GGGAAAAACATGTCAGGGTAGGG + Intergenic
1130682005 15:86005176-86005198 GGGAAAAATAGGTGGGCTTAAGG + Intergenic
1137809491 16:51339292-51339314 AGGAAAAATATGGAGGAGTAAGG - Intergenic
1138301412 16:55932880-55932902 GGGATACAAAGGTAGGAGTAGGG + Intronic
1138611526 16:58129020-58129042 GGGACAAAAAGGTCGGGCTAGGG - Exonic
1138764051 16:59578552-59578574 GGGAAAAAGAGATAGGAGAAAGG - Intergenic
1146931938 17:36783798-36783820 AGGAAAAATTGGCCGGAGTGAGG - Intergenic
1147286453 17:39406141-39406163 TGGAGAAATAGGTCTGAGTCTGG - Intronic
1147991880 17:44338953-44338975 GGGAAAAAGAGGTGGGGGTGGGG + Intergenic
1148254807 17:46120936-46120958 GGGAAAACTAGGTGGGAGCAGGG - Intronic
1149533034 17:57410823-57410845 AGGAAAAATAAGTGAGAGTATGG + Intronic
1150244581 17:63664814-63664836 GGGAAAAAGAGGAAGGAGGAAGG - Intronic
1156796888 18:41056836-41056858 GGGAAAAAAAGGTAGGTGGAGGG + Intergenic
1157161276 18:45316367-45316389 GGGAAGAGGAGGTCGGAGTGTGG + Intronic
1159794320 18:72823295-72823317 GGGAAAATTAGCTAGGATTAAGG + Intronic
1163520285 19:17787943-17787965 GGGAAAGATAGGTGGGTGTTGGG + Intronic
926462986 2:13156200-13156222 GGGAAAATTAGGAAGGAATATGG - Intergenic
926871197 2:17419719-17419741 GTGAAAAATAGGTCAGAATAGGG - Intergenic
929834964 2:45387278-45387300 AGGAAAAATAGGTAGGGGTAGGG - Intergenic
933082997 2:78017100-78017122 GGGAAGAAGAGGTCAGAGAAGGG - Intergenic
933796248 2:85922194-85922216 GGGAAAAATGGGTCTGACTCTGG - Intergenic
933942213 2:87254150-87254172 GGGAAAAATGCCTCTGAGTAGGG + Intergenic
936338013 2:111607420-111607442 GGGAAAAATGCCTCTGAGTAGGG - Intergenic
937021746 2:118663620-118663642 GGGAAAAATATGTCAAAGTAGGG - Intergenic
937100234 2:119263027-119263049 GGGAAAAAAAGGCTGGAGTGAGG - Intronic
939658058 2:144852294-144852316 GGTATAAATAGGTGAGAGTATGG - Intergenic
939879998 2:147620290-147620312 CAGAAAAATAGGTCACAGTAAGG - Intergenic
939892611 2:147755412-147755434 GGGAAAAATGGGTTGGAATTAGG + Intergenic
942153638 2:173104737-173104759 GGGGAAAATAGGGCAGAGTAAGG + Intronic
945152189 2:206803150-206803172 TGGAAAGAGAGGTGGGAGTAGGG + Intergenic
947029911 2:225782502-225782524 GGGAAAAAAAGGAAGGAGGAAGG - Intergenic
1177288444 21:19079986-19080008 GGGAGAAATTGGTCAAAGTATGG - Intergenic
1178153232 21:29820486-29820508 GGCAAAAATAGGTAGCAGAATGG + Intronic
1178946063 21:36948622-36948644 GGGAAGATTAGGTGGGAGGATGG + Intronic
1179785329 21:43726716-43726738 GGGAAAAATAGATCAGAAAATGG - Intronic
1181440172 22:22931666-22931688 GGGAGAAATAGGGCAGAGGATGG + Intergenic
949654660 3:6203839-6203861 GGGGAAAAAAGGTAGGAGAATGG + Intergenic
951023967 3:17811068-17811090 GTGAAAGATAGGTAGGAGAAGGG + Intronic
951460816 3:22949716-22949738 GGAAAAAATAGCTCAGAGTCAGG - Intergenic
951460904 3:22950781-22950803 GGAAAAAATAGCTCAGAGTCAGG + Intergenic
951786341 3:26423487-26423509 AGGAAAGGTAGGTAGGAGTAAGG + Intergenic
955019785 3:55108502-55108524 GGGAAAAATAAGTTGTTGTATGG + Intergenic
955931953 3:64066348-64066370 GGGCAAAATAGGACAGAGTGGGG - Intergenic
956203069 3:66727878-66727900 TGTAAAAATAGGTCGGTGTGGGG - Intergenic
956398978 3:68856225-68856247 GAGAAAACTAGGTAGGAGCATGG + Intronic
960659953 3:120046405-120046427 GGGAAATATGGGTGGGGGTAAGG + Intronic
961573026 3:127813944-127813966 GGGAAAAATAAGGAGGAGGAAGG - Intronic
963647535 3:147934796-147934818 GGGAAAAAAAGGGTGGACTAAGG - Intergenic
964669058 3:159205279-159205301 AGGAAACATAGGACAGAGTAAGG + Intronic
966412661 3:179659014-179659036 GGGAAGAAGAGGTGGGAGTAAGG - Intronic
966531885 3:180989965-180989987 GGAAAAAATCGGTCTGAGTAAGG - Intergenic
967657391 3:192067760-192067782 TGGTAAAATAGGTCTGGGTAGGG - Intergenic
967912344 3:194552707-194552729 GAGAAAAATATGGCGGAATAAGG - Intergenic
971621594 4:28861068-28861090 GGCAAAAAAAGGTGGGTGTAGGG - Intergenic
971648666 4:29242065-29242087 GAGAAAAATAGGACAGAGAAAGG - Intergenic
972585731 4:40435716-40435738 GGCAGAAATAGGCCTGAGTAAGG + Intronic
972946291 4:44260471-44260493 AGAAAAAATAAGTCAGAGTAAGG + Intronic
974919329 4:68219117-68219139 GGGAAAAAAATGTCAGAGAAGGG + Intergenic
975980388 4:80151626-80151648 GGCAAAACTAGGCTGGAGTAAGG + Intergenic
979351703 4:119650898-119650920 GGGAAAAGAAGGTCAGGGTAAGG + Intergenic
980268120 4:130546572-130546594 TGGAAAAATAGTTAGGATTAGGG - Intergenic
980337025 4:131488974-131488996 GGGAAAAACAGTTCAGATTATGG - Intergenic
981033621 4:140150771-140150793 GAGAGAAATAGGTTGGAGAAAGG + Intronic
982151134 4:152458758-152458780 GGGAAAAAGAGCTTGCAGTATGG + Intronic
984063302 4:175018914-175018936 GTGAAAAATAGCACAGAGTATGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
987186129 5:15420892-15420914 GGGAAAAATAAGTAGATGTATGG + Intergenic
987314786 5:16713937-16713959 GCGACAAATAGGTTGGAGTTTGG + Intronic
988301451 5:29433822-29433844 GGGAAAAATAGTTCAGAATTTGG - Intergenic
993680997 5:90877693-90877715 GGAAAAAATAGTTAGGTGTAAGG + Intronic
997635424 5:135400481-135400503 GAGAAAAATAAGGCGGAGAAGGG + Intergenic
1003894736 6:10596565-10596587 AGGAAAAATGGGAAGGAGTATGG + Intronic
1004212428 6:13662917-13662939 GAGAAAAAAAGGTAGGGGTATGG + Intronic
1007184151 6:39953414-39953436 GGGAAAAGTAATTCTGAGTAAGG - Intergenic
1007368718 6:41412551-41412573 GGCAAAAAGAGGTGGGAGTGTGG + Intergenic
1012128922 6:95466862-95466884 GGGAAAAATAAGCCGGAGGACGG - Intergenic
1013499994 6:110739523-110739545 GGGAAAATTAGGGGGAAGTAGGG - Intronic
1013754178 6:113441629-113441651 AGGCAAAAGAGGTCAGAGTAGGG - Intergenic
1022475505 7:30707117-30707139 GGGAAGAATAGGGTGGAGGATGG + Intronic
1023560229 7:41466414-41466436 AAGCCAAATAGGTCGGAGTAAGG - Intergenic
1023635339 7:42204043-42204065 GGGAAAAATGGTTTGGAGTGGGG - Intronic
1032009359 7:128332853-128332875 AGGAAAACTAGGTGGGAGTGGGG - Intronic
1037449014 8:18997869-18997891 GGGAAAAATAAGGCAGAGGAGGG - Intronic
1037762950 8:21754108-21754130 GGGAAAAATAGGTCGGAGTAGGG - Intronic
1037965673 8:23131959-23131981 GGGAAAGACAGATCGGTGTAGGG + Intergenic
1039399567 8:37257729-37257751 GGCAAAAATAAATCAGAGTAAGG - Intergenic
1041727524 8:61031858-61031880 GGGAAAAATGGGGCGGGGTGGGG + Intergenic
1055404447 9:75959829-75959851 GGGAGAAATAGGAATGAGTAAGG + Intronic
1056721017 9:89071985-89072007 GAGAAAAAGAGATAGGAGTAGGG - Intronic
1058789946 9:108434454-108434476 GGGAGAGAAATGTCGGAGTAAGG + Intergenic
1061274965 9:129564724-129564746 GGGAAAAACAGGACTGAGGATGG + Intergenic
1186656917 X:11622519-11622541 GGGGAAGATAGGTAGGAGAAGGG + Intronic
1189321167 X:40088457-40088479 GGGAAAAAGAGGGAGGAGGAGGG + Intronic
1191665597 X:63699198-63699220 GGGAAAAAAAAGTGGGAGAAGGG - Intronic
1198374912 X:136029252-136029274 TGGAAAAGTAGGTTGGAGTGGGG + Intronic
1199206876 X:145159616-145159638 GGGAAAAATTGGTCAGAACAAGG + Intergenic