ID: 1037763175

View in Genome Browser
Species Human (GRCh38)
Location 8:21755816-21755838
Sequence ATGGCTGAAGGCCCTTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037763175_1037763180 -9 Left 1037763175 8:21755816-21755838 CCAAGACAAGGGCCTTCAGCCAT 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1037763180 8:21755830-21755852 TTCAGCCATGTTGGGGCATGTGG No data
1037763175_1037763182 0 Left 1037763175 8:21755816-21755838 CCAAGACAAGGGCCTTCAGCCAT 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1037763182 8:21755839-21755861 GTTGGGGCATGTGGCCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037763175 Original CRISPR ATGGCTGAAGGCCCTTGTCT TGG (reversed) Intronic
900512503 1:3067304-3067326 ATTGCTCATGGCCCTTCTCTAGG + Intergenic
900731741 1:4266435-4266457 ATGGATGAATGCCATTGTCTTGG + Intergenic
900963405 1:5940209-5940231 ATGGATGAATGCCATTGTCTCGG + Intronic
904801846 1:33098662-33098684 ATTGCTGGAGGCCCTGGGCTGGG - Intronic
905887109 1:41497273-41497295 ATGGGTGAAGACCCTTCTCCTGG + Intergenic
906565999 1:46801514-46801536 CTGTCTGAAGGGCCTTCTCTTGG + Intronic
906569445 1:46823719-46823741 ATTGCTGTAGGACCTTCTCTGGG - Intergenic
911659527 1:100485649-100485671 TTGGTTTAAGGCCCTTGTCCGGG - Intronic
913128355 1:115814331-115814353 ATGCCAGCAGACCCTTGTCTTGG - Intergenic
915280680 1:154820229-154820251 AGGGCTGCAGGCCCTGGACTGGG + Intronic
916168653 1:161984664-161984686 ATGGCTAAAGGACCTTTCCTTGG - Intronic
919772418 1:201171098-201171120 CTGGCTGGAGGCCCGAGTCTCGG - Intronic
1063437772 10:6048453-6048475 ATGGCCAAAGGCCCTTCCCTCGG - Intronic
1063598386 10:7458213-7458235 GCGGCTGAAGGCCCTTCTCAAGG + Intergenic
1063856226 10:10257198-10257220 ATAGCAGATGGCCCTTGGCTTGG + Intergenic
1065983504 10:30927108-30927130 TTGGCTGAAATCTCTTGTCTTGG - Intronic
1067354039 10:45507586-45507608 ATGGCTTAATGCCCTCCTCTGGG - Intronic
1070668998 10:78364938-78364960 CATGCTGAAGGCCCATGTCTGGG - Intergenic
1072804447 10:98415688-98415710 GTGTCTGAAGGCCCTGGTCGTGG - Intergenic
1078171495 11:8932230-8932252 AAGCCTGAAGGCCCCTGGCTGGG - Exonic
1081536890 11:44002878-44002900 ATGGCTGCATGGCCTTGTCCAGG + Intergenic
1085188995 11:74601489-74601511 ATGGCAGAAGCTCATTGTCTAGG + Intronic
1087308007 11:96506753-96506775 AAGGCTGAACTCCCTTGTCCAGG + Intronic
1087559497 11:99768584-99768606 ATGACTCAAGACCATTGTCTTGG - Intronic
1088910411 11:114186750-114186772 AATTCTGAATGCCCTTGTCTAGG - Intronic
1089377425 11:118004537-118004559 ATTGCTGAAAGACCTTTTCTTGG - Intergenic
1092013735 12:5139176-5139198 AGGGCAGCAGGCACTTGTCTTGG + Intergenic
1094474809 12:30832993-30833015 AGAGGTGAAGGCCCTTGTCCAGG + Intergenic
1095954989 12:47800739-47800761 GTGGCTGAAGCCACTGGTCTTGG - Intronic
1097220666 12:57449029-57449051 ATGGATTAATGCCCTTATCTTGG - Intronic
1097295587 12:57958726-57958748 AGGGCTGAAGGCCATTGTTCAGG - Intergenic
1098267966 12:68742417-68742439 ATGGGTCAAGTCCCTGGTCTAGG - Exonic
1103737890 12:123071942-123071964 ATGGCTGAAGTCCCCTTTCCAGG - Intronic
1105583948 13:21726654-21726676 CTGTCTGAAGGACCTTTTCTGGG - Intergenic
1106402875 13:29446214-29446236 ATGACTGTAGGACCTGGTCTGGG - Intronic
1107200854 13:37715123-37715145 AGAGCTGAAAGCACTTGTCTAGG + Intronic
1110153134 13:72279032-72279054 ATAGATGAAGGCCTTAGTCTAGG + Intergenic
1111696830 13:91635134-91635156 AAGGTTGGAGGCCCTAGTCTGGG - Intronic
1113288955 13:108884577-108884599 ATGGGTGAGAGCCCCTGTCTCGG - Intronic
1117684427 14:58238815-58238837 ATGGCTGAAGGGCATTGTCAGGG + Intronic
1122144439 14:99681163-99681185 AGGGCTGAAAGCCCTTTTCCTGG - Intergenic
1122920248 14:104876953-104876975 AAGGCTGGAGGCCCCTCTCTGGG + Intronic
1128760634 15:70214060-70214082 TTGGCTGAAGGCCCCACTCTAGG + Intergenic
1129131439 15:73501017-73501039 ATGGCTCAAAGGCCTTGTTTGGG + Intronic
1130175764 15:81568782-81568804 ATTGCTGAGCCCCCTTGTCTTGG - Intergenic
1130321847 15:82848507-82848529 ATGGCTGCAGTCCCTTCCCTAGG + Intronic
1136052372 16:27661036-27661058 ATGACTGAAGTCCCTTGTGTGGG - Intronic
1136772601 16:32854950-32854972 ATGGCTGGAGGCTCTTCCCTGGG - Intergenic
1136898013 16:34006569-34006591 ATGGCTGGAGGCTCTTCCCTGGG + Intergenic
1136932952 16:34435453-34435475 ATGGCTGGCTCCCCTTGTCTGGG + Intergenic
1136971620 16:34976361-34976383 ATGGCTGGCTCCCCTTGTCTGGG - Intergenic
1137427565 16:48392401-48392423 ATGGCTCATGGCCCCTTTCTGGG - Intronic
1140052750 16:71497213-71497235 AGTGCTGAAGGGCCTAGTCTAGG - Intronic
1203075026 16_KI270728v1_random:1117060-1117082 ATGGCTGGAGGCTCTTCCCTGGG - Intergenic
1142649951 17:1342377-1342399 AAGGCTCAAGGCATTTGTCTGGG + Intergenic
1142940639 17:3377664-3377686 AGGGCTGCAGGCACTTCTCTGGG + Intergenic
1144998168 17:19285354-19285376 ATGGCTACAGGCCCTGGACTCGG - Intronic
1145393104 17:22471212-22471234 ATGGATCAATGCCCTTATCTCGG + Intergenic
1145869306 17:28260340-28260362 AAGGCTGAACTCCCTTGTCCAGG + Intergenic
1146658375 17:34648661-34648683 AGGGCTGCAGTCCCTGGTCTTGG + Intergenic
1148124084 17:45228071-45228093 CTCGCTGAAGGCCCTGGTCTGGG + Intronic
1148807266 17:50270340-50270362 ATGGCTGATGGCACTAGGCTGGG - Intergenic
1149031263 17:52085237-52085259 ATCACTGAGGGCCTTTGTCTAGG - Intronic
1151561292 17:74871260-74871282 AGCGCTGAAGCCCCTTGTCCTGG + Intronic
1151819979 17:76492089-76492111 GGGGCTGAAGGCCCTTCTCTGGG - Intronic
1154261537 18:12838389-12838411 CTGGCTGAAGGTCTTTCTCTAGG - Intronic
1159580293 18:70228134-70228156 AAGGCTAAAGGCATTTGTCTAGG + Intergenic
1163020830 19:14480041-14480063 AGGGCTGAGGGCGCTTGGCTGGG + Intronic
1164940636 19:32250476-32250498 ATGGCTGAAACCCCATTTCTGGG + Intergenic
1166520620 19:43477837-43477859 GTGGCTGAAGGCCAGAGTCTGGG + Intronic
927971231 2:27307273-27307295 CTGGCTGAAAGCCGCTGTCTCGG + Exonic
937060864 2:118979544-118979566 CTGGCTGAGGCCCCTTCTCTGGG - Intronic
937245079 2:120487256-120487278 ATGGCTGATGGCACTTGTGAAGG + Intergenic
937468986 2:122159110-122159132 ATGGCTGATGGCCCGGCTCTGGG + Intergenic
940049104 2:149442271-149442293 GTAACTGAAGGCCTTTGTCTAGG + Intronic
942133864 2:172906478-172906500 ATGTCTGAAACCCCTTGGCTGGG - Intronic
944183502 2:196923093-196923115 ATGGCTGAAGGACCATGGGTAGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
949032160 2:241802360-241802382 GTGGCTGCAGGCCCTTCTTTGGG + Intronic
1168805316 20:669347-669369 GTGGGTCAAGGCCTTTGTCTGGG - Intronic
1169689461 20:8314457-8314479 TTGGCTGAAAGCCCTTCTGTGGG - Intronic
1171265622 20:23769755-23769777 ATGGTGGTAGGGCCTTGTCTGGG - Intergenic
1172637385 20:36419043-36419065 ATGGCTGAAGTCACCTCTCTAGG - Intronic
1173922770 20:46758504-46758526 CTGGCTGATGGCCCCTGTGTTGG - Intergenic
1174857889 20:54064265-54064287 ATGGCTGAGAGCCCCTGTTTTGG + Intronic
1176425996 21:6548545-6548567 ATGTCTGAAGGCCCCTCCCTGGG + Intergenic
1179375929 21:40849588-40849610 ATGGGTGAAGGACCTTGAATGGG + Intergenic
1179701487 21:43156862-43156884 ATGTCTGAAGGCCCCTCCCTGGG + Intergenic
950692961 3:14675438-14675460 ATGGGTGTAGGTCATTGTCTAGG + Intronic
950832686 3:15890838-15890860 TTGGCTGGAGGGCTTTGTCTTGG - Intergenic
953493103 3:43366088-43366110 GTGGCTGCTGGCCCTTGGCTTGG + Exonic
953919278 3:46940820-46940842 ATCTCAGAAGGCCCTTGTCGAGG - Intronic
953957885 3:47245600-47245622 ATGGGTGAGGCCCCTTGTGTGGG + Intronic
960708736 3:120506379-120506401 ATGGCTGAAGGACTTATTCTGGG - Intergenic
962417143 3:135193385-135193407 GTTGCTGAAGGCCTTTGGCTGGG + Intronic
963164311 3:142185182-142185204 GTGGCAGAAGGCCCCAGTCTAGG + Intronic
964832814 3:160904546-160904568 ATGGCTGTAGACTCTTGTATTGG + Intronic
965785841 3:172333718-172333740 ATGGCCAAATGCCCTTGCCTGGG + Intronic
965841657 3:172912233-172912255 ATGGCAGAATAGCCTTGTCTGGG - Intronic
977060796 4:92254981-92255003 ATGGCTGCCGTCCCTTGCCTGGG + Intergenic
979615065 4:122733107-122733129 ATGGCTGAAGGCCCAGCTCCAGG - Intronic
982980611 4:162129558-162129580 AAGGCTTAAGTCCCTTCTCTGGG - Intronic
986791845 5:11169186-11169208 AAGGCTGTAGGTCCTTGGCTGGG - Intronic
987545814 5:19309347-19309369 TTGGCTGAAGGGACTTGCCTTGG - Intergenic
991619342 5:68529406-68529428 ACAGCTGAAATCCCTTGTCTGGG - Intergenic
993028676 5:82676956-82676978 ATGTCTGAAGGGGCTTGTGTGGG - Intergenic
996829629 5:127726523-127726545 ATGGCTGCTGCCCCTTCTCTGGG - Intergenic
1002925542 6:1604210-1604232 GTGGCTGAAAGCCCCAGTCTCGG + Intergenic
1004234910 6:13866486-13866508 ATGGCAGATGGCACTTGTCACGG - Intergenic
1005438086 6:25836486-25836508 AAGGCTGAACTCCCTTGTCCAGG - Intronic
1006904933 6:37526907-37526929 ATGGCTGATGGCCCTTGGCCTGG + Intergenic
1007766886 6:44165950-44165972 TTGTCTGAAGGCCCTGGCCTCGG + Intronic
1011294304 6:85809832-85809854 AAGGCTAAAGGCCCTTTTTTTGG + Intergenic
1011502370 6:88005100-88005122 CTGGCTGGAGGCCCTTGTGAGGG + Intergenic
1011777044 6:90742467-90742489 ATAGCAGAATGCCCTAGTCTGGG - Intergenic
1013056374 6:106587141-106587163 ATGTCTGAAAGCCCCAGTCTGGG + Intronic
1017496323 6:154986907-154986929 CTGGCTGAAGTCCATTGTCTAGG + Intronic
1022101371 7:27171342-27171364 ATGCCTGTAAGCCCTTCTCTTGG + Exonic
1030653174 7:112137739-112137761 ATGGCTGCAGAACCTTGGCTTGG - Intronic
1032313054 7:130806296-130806318 AGGACTGAAGGCCAATGTCTTGG - Intergenic
1036686494 8:10914891-10914913 TTTGCTCAAGGCCTTTGTCTGGG + Intronic
1037627278 8:20619123-20619145 ATGGCTTTAGACCCTTGTTTTGG + Intergenic
1037763175 8:21755816-21755838 ATGGCTGAAGGCCCTTGTCTTGG - Intronic
1038666125 8:29539747-29539769 AAGCTTGAAGGCCCTTGGCTTGG - Intergenic
1042359697 8:67868584-67868606 ATGGCTGTAGGTCCTTATCTAGG + Intergenic
1046671582 8:117062503-117062525 ATGGCTTAGCGCCCTTGCCTTGG - Intronic
1049855584 8:144859738-144859760 AAGGCTGAACTCCCTTGTCCAGG - Intergenic
1050718061 9:8552645-8552667 ATGGATGATGACCCTTCTCTGGG + Intronic
1051706935 9:19890594-19890616 ATGTCTGAAGGCTCTTTCCTTGG + Intergenic
1052681810 9:31702337-31702359 ATAGCTCAAGGTCCTTTTCTAGG + Intergenic
1056972964 9:91223883-91223905 AGGCCTGAAGGTCCTTTTCTGGG - Intronic
1057720229 9:97526429-97526451 TAGGATGAAGACCCTTGTCTAGG - Intronic
1061084180 9:128389727-128389749 GCGGCTGAGGGCCCTTCTCTGGG + Exonic
1062436064 9:136547056-136547078 ATGGCAGAAGGCGCGTGTCCCGG + Intergenic
1189307148 X:39995485-39995507 ACTGCTGAAGGCCTTTGTGTGGG + Intergenic
1190215821 X:48478741-48478763 CTGGGTGAAGGCCCTTACCTGGG + Intronic
1190530954 X:51375562-51375584 ATGGCTGAATGCACTTTCCTTGG - Intergenic
1192873129 X:75204094-75204116 AAGGCTGAACTCCCTTGTCCAGG - Intergenic
1194141568 X:90216274-90216296 AAGGCTGAACTCCCTTGTCTAGG - Intergenic
1194195239 X:90883804-90883826 ATGGCTGGAGTCCCAGGTCTGGG + Intergenic
1197618660 X:128722153-128722175 ATGTCTCAAGGCCCATGTCTGGG + Intergenic
1200487320 Y:3785377-3785399 AAGGCTGAACTCCCTTGTCTAGG - Intergenic