ID: 1037764661

View in Genome Browser
Species Human (GRCh38)
Location 8:21765046-21765068
Sequence CTTCTGGGCTGCATCTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037764657_1037764661 25 Left 1037764657 8:21764998-21765020 CCATGTCACTGAATCAGAAAGTC 0: 1
1: 0
2: 0
3: 29
4: 265
Right 1037764661 8:21765046-21765068 CTTCTGGGCTGCATCTGACCAGG No data
1037764656_1037764661 28 Left 1037764656 8:21764995-21765017 CCTCCATGTCACTGAATCAGAAA 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1037764661 8:21765046-21765068 CTTCTGGGCTGCATCTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037764661 Original CRISPR CTTCTGGGCTGCATCTGACC AGG Intronic
No off target data available for this crispr