ID: 1037765415

View in Genome Browser
Species Human (GRCh38)
Location 8:21769471-21769493
Sequence TCCAGCTGCCCTGCAAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 8, 3: 44, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037765415_1037765422 17 Left 1037765415 8:21769471-21769493 CCAGTGCTTGCAGGGCAGCTGGA 0: 1
1: 0
2: 8
3: 44
4: 303
Right 1037765422 8:21769511-21769533 TAAGAAACATGAGGTTCAGGGGG No data
1037765415_1037765418 8 Left 1037765415 8:21769471-21769493 CCAGTGCTTGCAGGGCAGCTGGA 0: 1
1: 0
2: 8
3: 44
4: 303
Right 1037765418 8:21769502-21769524 CCTTACAGATAAGAAACATGAGG No data
1037765415_1037765421 16 Left 1037765415 8:21769471-21769493 CCAGTGCTTGCAGGGCAGCTGGA 0: 1
1: 0
2: 8
3: 44
4: 303
Right 1037765421 8:21769510-21769532 ATAAGAAACATGAGGTTCAGGGG No data
1037765415_1037765419 14 Left 1037765415 8:21769471-21769493 CCAGTGCTTGCAGGGCAGCTGGA 0: 1
1: 0
2: 8
3: 44
4: 303
Right 1037765419 8:21769508-21769530 AGATAAGAAACATGAGGTTCAGG No data
1037765415_1037765420 15 Left 1037765415 8:21769471-21769493 CCAGTGCTTGCAGGGCAGCTGGA 0: 1
1: 0
2: 8
3: 44
4: 303
Right 1037765420 8:21769509-21769531 GATAAGAAACATGAGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037765415 Original CRISPR TCCAGCTGCCCTGCAAGCAC TGG (reversed) Intronic
900012804 1:131376-131398 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
900042868 1:487363-487385 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
900064305 1:722360-722382 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
900120923 1:1048323-1048345 TGCAGCTGCCCGGCAGGCAGGGG + Exonic
900596471 1:3482354-3482376 CCCAGCTGCCCTGCAGCCTCCGG + Intergenic
901188421 1:7389511-7389533 TGCAGCACCCCTGCCAGCACAGG + Intronic
901956150 1:12787304-12787326 GCCAGGGTCCCTGCAAGCACAGG - Intergenic
901979530 1:13023373-13023395 GCCAGGGTCCCTGCAAGCACAGG - Intronic
902002553 1:13205565-13205587 GCCAGGGTCCCTGCAAGCACAGG + Intergenic
902021787 1:13351329-13351351 GCCAGGGTCCCTGCAAGCACAGG + Intergenic
902443850 1:16449030-16449052 ACCAGCTGCCCTGCAATCACTGG - Intronic
904611629 1:31729007-31729029 TCCACTTGTCCTGCAAACACAGG + Intronic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
906607760 1:47183487-47183509 CCCAGCTGCCCTGTGGGCACAGG + Intergenic
907091892 1:51732817-51732839 TCCAGCTGCCCAGCATGTCCTGG + Intronic
907444437 1:54498971-54498993 TCCAGCTGCCCTGCAGGACCTGG + Intergenic
907461244 1:54607074-54607096 TCCAGCTCCCATGCAAGCAGCGG - Intronic
910220978 1:84889213-84889235 TCCAGCTGGCTTGCCAGGACAGG + Intronic
913371671 1:118106470-118106492 TGCAGTTGGCCTGGAAGCACTGG + Intronic
914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
916674515 1:167054460-167054482 CCCTGCTGCCCTGCAGGAACCGG - Exonic
918143357 1:181736136-181736158 ACAAGGTGCCCTGCAGGCACTGG - Intronic
920630776 1:207649431-207649453 TCAAGCTGCCCTAAAAGGACAGG - Intronic
922099205 1:222468372-222468394 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
922261242 1:223947866-223947888 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
922707809 1:227798955-227798977 TCCAGCAGCCAATCAAGCACTGG + Intergenic
922735830 1:227977874-227977896 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923207023 1:231768970-231768992 TCCAGCTGCCCTCTGAACACAGG - Intronic
924004008 1:239587027-239587049 TCCAGCTTCTCTACAAGCATGGG - Intronic
924342409 1:243050046-243050068 GCCATCTGCCCTGAAAGCCCAGG + Intergenic
1062884606 10:1006764-1006786 TCCAACTGCCCTTCACGAACCGG - Intronic
1062906778 10:1184828-1184850 TCCAGTTTCCCTGCAAGGATGGG + Intronic
1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG + Intergenic
1065859459 10:29859345-29859367 CCCAGCTGCCCTGCTGGCAGAGG + Intergenic
1066734068 10:38455509-38455531 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1067741403 10:48898362-48898384 GCCAGCTGCCCTGGAGGCCCAGG - Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1070450070 10:76549138-76549160 TTCAGCTGCCCTGGGAGCCCAGG + Intronic
1070827327 10:79398911-79398933 GCCTGCTGCCCTTCACGCACTGG - Intronic
1071523720 10:86346405-86346427 CCCAGCTGCCCTCCAAACACAGG - Intronic
1071766055 10:88666732-88666754 CCCAGCTACCCTGGAAGCAGAGG + Intronic
1072143507 10:92612249-92612271 TCCAGCTACCCTGGAGGCTCAGG - Intronic
1072440137 10:95447023-95447045 TCCAGCTGCTCTGGAGGCAGAGG + Intronic
1072780131 10:98244759-98244781 TCCAGCTGCACTGCAGCCAGGGG + Exonic
1074087406 10:110218791-110218813 CCCAGTTGCCCTACAAGCTCGGG - Intronic
1074188199 10:111114824-111114846 CCCAGCAGCCCTCCAAGCAGAGG + Intergenic
1074778804 10:116785706-116785728 TCCACCTGCCCTCTGAGCACTGG + Intergenic
1074939370 10:118219599-118219621 CCCAGCTGCCCTGAAAACAGTGG - Intergenic
1075776369 10:124991506-124991528 GCCATGTGACCTGCAAGCACCGG + Intronic
1075872704 10:125782314-125782336 TCAGGCTGAACTGCAAGCACTGG + Intergenic
1076212158 10:128657553-128657575 CCCAGCTGCCCTGACAGCTCAGG + Intergenic
1076817110 10:132920478-132920500 TCCAGCTGCCCTCCAAGCAGAGG + Intronic
1076969140 11:123580-123602 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1077364970 11:2157993-2158015 GCCAGCTGCCCTGCAAGTCCTGG + Intronic
1077820696 11:5737021-5737043 TCACGCTGTGCTGCAAGCACAGG - Exonic
1078322895 11:10352694-10352716 ACCAGCTGCCCTGGACGCTCTGG - Intronic
1079555995 11:21759625-21759647 TCCAGCTGCCCTGGTGCCACAGG - Intergenic
1080365430 11:31568967-31568989 TCCAGCTACCCTGGAAGCTGAGG + Intronic
1080780173 11:35421907-35421929 TTCAGCTGCCCTGGAAGACCAGG + Intergenic
1081823220 11:46021173-46021195 TCCAGCTGCTCTGGAAGCTGAGG - Intronic
1083008275 11:59368938-59368960 TCCAGCTGTCCTGTAAGCCTAGG + Intergenic
1084342910 11:68519968-68519990 TCCCGGTGCCCTGGAAGCAGTGG - Intronic
1084700132 11:70781295-70781317 GCCAGCTGCCCAACAGGCACTGG + Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1087147452 11:94826175-94826197 TCCAGCTGCCCTGGAGGCTGAGG + Intronic
1088628621 11:111752157-111752179 ACCAGCTGGCCTGCCAGCAGCGG + Exonic
1088976125 11:114817921-114817943 TCCTGCTGTCCTGCATGAACAGG + Intergenic
1090270334 11:125381363-125381385 TCCAGCTGCTCTGCAACCTGAGG - Intronic
1091991603 12:4960355-4960377 CCCAGCAGCCCTGCCAGCCCGGG - Intergenic
1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG + Intronic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1093521261 12:20052859-20052881 CCCAGCTGCACGGCAAGCAGAGG - Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1096513558 12:52144749-52144771 TCCAGCTGCCATCCAGGCCCAGG - Intergenic
1096636156 12:52960905-52960927 TCCATCTGCCCTTTAAACACAGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098584389 12:72138756-72138778 GCCAGATGACCTACAAGCACTGG - Intronic
1099380896 12:81951047-81951069 TCCACATGACCAGCAAGCACCGG - Intergenic
1100038415 12:90281628-90281650 TACAGCAGCCCTCCAATCACAGG + Intergenic
1101754407 12:107609696-107609718 TCCCCCTGTCCTGCAATCACAGG - Intronic
1103713500 12:122929817-122929839 CCCAGCTGCCCTCCGAGCCCAGG - Exonic
1103812207 12:123624372-123624394 TCCAGCTGCCCAGGAAGCTGAGG - Intronic
1104039212 12:125118628-125118650 TCCAGCCGACCTGCAAAGACAGG - Exonic
1104996466 12:132660884-132660906 TCCAGGAGCCCAGGAAGCACGGG + Intronic
1105313734 13:19237142-19237164 CCCAGCTGCCATGCCAGCACAGG + Intergenic
1107456530 13:40560592-40560614 TCCAAATGGCCTGCAAGCCCTGG - Exonic
1111141556 13:84126744-84126766 GCCAGCTGCTCTGGCAGCACGGG + Intergenic
1113670909 13:112175522-112175544 AGCAGCAGCCCTGCCAGCACGGG + Intergenic
1113878290 13:113608144-113608166 TCCACATGCCCTGCAGGCATGGG + Intronic
1113948185 13:114056603-114056625 CCCAGGTGCCCAGCCAGCACGGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118183492 14:63517573-63517595 TCCAGTTTCGCTTCAAGCACTGG + Intronic
1118806175 14:69238875-69238897 TCCACCTGCCTTGGAAGAACTGG + Intronic
1118985246 14:70748876-70748898 TCCAGTTGTCCTGCAGGCAGTGG + Exonic
1119674562 14:76544212-76544234 TCCAGCTGCTCTGCTGGCTCCGG + Intergenic
1119748073 14:77058666-77058688 TCCTGCTTCCCAGCAAGCTCAGG + Intergenic
1120957016 14:90091782-90091804 TCCTTCTCCCCTGCCAGCACTGG - Intronic
1121252015 14:92506343-92506365 TGCTGCTGACCTGCAAGCAGGGG + Intergenic
1121407171 14:93726110-93726132 GCCTGCTGCCCTCCAAGCCCAGG - Intronic
1122618401 14:103037643-103037665 TACAACTGCCCTCCAAGGACGGG + Intronic
1122904252 14:104794874-104794896 CCCAGCTGCCCTCCAAGCCTTGG + Intronic
1122910861 14:104826976-104826998 TCCAGCTTCCCTGGGAGCCCGGG - Intergenic
1123419670 15:20121441-20121463 TCTAGCAGCCAAGCAAGCACTGG - Intergenic
1123446194 15:20332095-20332117 TCTAGCAGCCAAGCAAGCACTGG + Intergenic
1123528893 15:21127977-21127999 TCTAGCAGCCAAGCAAGCACTGG - Intergenic
1124218857 15:27832239-27832261 CCCACCTGCCCTGCACACACTGG + Intronic
1124621116 15:31274672-31274694 AACAGCTGCCCTGCAAGTAGAGG - Intergenic
1124633454 15:31350290-31350312 TCCAGGTGCCCTGCACGCTGGGG - Intronic
1125577030 15:40763322-40763344 TCCAGCTGCGCGGGAAGCTCAGG + Intergenic
1127553987 15:60069291-60069313 TCTATCTGCCGTGCAAGCACTGG - Intergenic
1127892217 15:63263662-63263684 TCCTGCTTCTCTGAAAGCACAGG + Exonic
1128760002 15:70210145-70210167 TCCTGCTGCACTGAAAGCCCTGG - Intergenic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1129200690 15:73997165-73997187 TCCATCTGCCCTGCAGGAAATGG + Intronic
1129651900 15:77496971-77496993 GCCAGCTCTCCTGCCAGCACTGG - Intergenic
1130215700 15:81966932-81966954 TCCAGCTGCTCTGGAAGCCGAGG + Intergenic
1131421808 15:92312575-92312597 TCCAGCAGCCCTGCCCTCACTGG - Intergenic
1131520342 15:93109739-93109761 CGCAGCTGAGCTGCAAGCACTGG + Intergenic
1132759154 16:1500550-1500572 GCCAGCAGTTCTGCAAGCACCGG - Exonic
1134246891 16:12546883-12546905 TCCAGCTGCACTCCTAGCCCTGG - Intronic
1135610803 16:23865416-23865438 TCCAGCTGCCCTGGAGGCTGAGG - Intronic
1137519741 16:49182052-49182074 TCCAGCTTCCCAGGAAGCAGAGG - Intergenic
1137603324 16:49770953-49770975 TCCAGCACCCCTCCAAGCTCTGG - Intronic
1139467785 16:67163443-67163465 TCCAGCTCCACTGCCAGCCCAGG - Exonic
1140299065 16:73738812-73738834 TCCAGCTGACATGGAAGCCCGGG - Intergenic
1142307133 16:89292069-89292091 TCCAGCTGCCCTGCGGGTTCTGG + Intronic
1142451534 16:90175542-90175564 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1203137415 16_KI270728v1_random:1737307-1737329 TCTAGCAGCCAAGCAAGCACTGG + Intergenic
1142811598 17:2398025-2398047 CCCAGGTGCTCTGCAGGCACAGG + Intronic
1144512225 17:15886967-15886989 TCTGGTTGCCTTGCAAGCACGGG - Intergenic
1144793709 17:17877047-17877069 TCCAGCTACGCTGACAGCACAGG + Intronic
1144849311 17:18235983-18236005 TCCAGCAGCCCTGAAAGCCACGG - Intronic
1145901030 17:28490648-28490670 TCCAGCTTCCCTTCAGGGACTGG - Intronic
1146000358 17:29126920-29126942 CCCATCTGCCATCCAAGCACAGG + Intronic
1146690967 17:34875876-34875898 TCCAGCTACCGTGTAAGCAGGGG + Intergenic
1146744044 17:35313019-35313041 TCCAGCTACCCTCCAAGAACAGG - Intergenic
1146921616 17:36716515-36716537 TCCAGCTGCAGTGTAACCACTGG - Intergenic
1147403438 17:40194442-40194464 TCGTGCTGCCCTGCATGCCCAGG + Exonic
1147721767 17:42543848-42543870 GCCAGCTGCCCAGCAAGAAGCGG - Exonic
1147982006 17:44280512-44280534 GCCTGCTGCCCTGAAAGCAGAGG - Intergenic
1149821753 17:59786687-59786709 ACCAGCTTCCCTGTAACCACAGG + Intronic
1151871835 17:76841784-76841806 TCCAGGTGCCCTGGACCCACTGG - Intergenic
1151931897 17:77237727-77237749 TCCTCCTGCTCTGCAAACACTGG - Intergenic
1152308576 17:79535574-79535596 TGCAGCAGACCTGCAAGCCCAGG - Intergenic
1153278258 18:3390255-3390277 GCCAGCATCCCTGCCAGCACTGG - Intergenic
1154162802 18:11992406-11992428 GCCAGCTGCCCTGCAGTGACTGG + Intronic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1156455363 18:37290198-37290220 TCCAGCTGCTGTGCATGGACAGG - Intronic
1157697872 18:49738058-49738080 TCCAGCTGACCTGCATTCTCTGG + Intergenic
1160645946 19:193506-193528 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1161044380 19:2127262-2127284 TCCAGCTGAGCTGCCGGCACTGG - Intronic
1161302134 19:3547872-3547894 CCCTGCTGCTCTGGAAGCACTGG - Exonic
1163675908 19:18655176-18655198 TCCAGCCGCCCTGCAAGAGAGGG - Intronic
1163860619 19:19740902-19740924 TACAGCTGCCCTGCCCGCGCAGG + Intergenic
1164442361 19:28289068-28289090 TCCAGCAGCTGAGCAAGCACTGG - Intergenic
1164586928 19:29481618-29481640 TCTAGCTGACCTGCAGGAACAGG - Intergenic
1164649114 19:29879434-29879456 TCCAGCAGCCCTGCACCCAGGGG - Intergenic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1166774164 19:45302532-45302554 TCCTGCTGGCCTGCCTGCACGGG + Exonic
1167646803 19:50710434-50710456 ACCAGCTGCCCTTCAAGGGCAGG + Intronic
1168537188 19:57180839-57180861 TCCAGCTACCCTGCAGGCTGAGG + Intergenic
925338230 2:3114529-3114551 AGCAGCTGCTCTCCAAGCACAGG + Intergenic
925413431 2:3653416-3653438 TCCAGGTGACCGGCAAGGACTGG + Intergenic
926148682 2:10412458-10412480 TCCAGGTGCCCAGCAAGAAAGGG + Intronic
927510687 2:23642322-23642344 TCCATCTCCCTTGCAGGCACAGG + Exonic
927878818 2:26676174-26676196 TGAACCTGCCCTGCAGGCACAGG - Intergenic
927967908 2:27283110-27283132 TCCAGCTGCCGTCTATGCACAGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
934040500 2:88124237-88124259 TCCACCTGCCCTGCATGCCCAGG - Intronic
934654065 2:96108274-96108296 TCCAGCTGCCAGGCCAGCAGGGG + Intergenic
936147802 2:109993069-109993091 TCTAGCAGCCAAGCAAGCACTGG - Intergenic
936196889 2:110378378-110378400 TCTAGCAGCCAAGCAAGCACTGG + Intergenic
936239418 2:110773973-110773995 TCCAGCTGCACTGGAATCCCAGG - Intronic
936527777 2:113253444-113253466 ACCAGCTGTCATGCAAGCTCAGG + Intronic
937127339 2:119482921-119482943 TGCAGCTCCCCTGCCAGCTCGGG + Intronic
938379577 2:130829082-130829104 TCCACCTGCCCTGCAGCCTCGGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
944630427 2:201618842-201618864 TCCAGGTGCCCTGCTGGCCCCGG + Intronic
945134175 2:206608706-206608728 TCTACCTGCCCACCAAGCACTGG + Intronic
945448208 2:209963158-209963180 TCCAGCTGCTTTGGCAGCACTGG - Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948454947 2:238100595-238100617 CCCAGCTGCCCGGCAACCAGCGG + Exonic
948458211 2:238117050-238117072 CCCAGCTGCCCTGGAGGCATGGG + Intronic
948604768 2:239127856-239127878 CCCAGCTGCCCTGCGAGCCCTGG - Intronic
948679800 2:239626059-239626081 TCCAGCAGCCCTGCCCGCCCCGG - Intergenic
948702125 2:239767055-239767077 TCCCCCAGCCCTGCAGGCACAGG - Intronic
948703493 2:239775384-239775406 TCCAGCTGCCCTGAAAAGAGAGG + Intronic
948885643 2:240882133-240882155 TGCAGCTGCCCTGCTCTCACAGG + Intergenic
1170843509 20:19943076-19943098 TCCCGATGCCCTTCAAGCCCGGG - Intronic
1174985363 20:55445766-55445788 TCCAGCCACTCTGCATGCACTGG + Intergenic
1176265156 20:64205417-64205439 TCCGGGTTCCCTGCAAGGACTGG + Intronic
1176279560 20:64292710-64292732 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1178408944 21:32348044-32348066 TCCACCTGCCCCGGAAGGACTGG + Intronic
1179984029 21:44911426-44911448 CCCAGCTCTCCTCCAAGCACAGG - Intronic
1180019904 21:45116280-45116302 TGCTGCTGCGCAGCAAGCACAGG - Intronic
1180150664 21:45945590-45945612 TCCAGCTCCCCTGCTGGCACTGG + Intergenic
1180552231 22:16549859-16549881 TCTAGCAGCCAAGCAAGCACTGG + Intergenic
1180834651 22:18923797-18923819 TCCACCTGCCCTGGGAGAACAGG + Intronic
1181351799 22:22264200-22264222 TCTAGCAGCCAAGCAAGCACTGG - Intergenic
1181629890 22:24145245-24145267 ACTAGCTGCCCTGAATGCACTGG + Intronic
1181879268 22:25964824-25964846 TCCAGCTGCCCTGCGACCTTGGG - Intronic
1182747925 22:32619942-32619964 GCCAGCTGACCTCCAAACACAGG + Intronic
1183474557 22:38028889-38028911 TCCAAAGGCCCTGCAAGCCCCGG + Intronic
1185045615 22:48527320-48527342 ACCAGCTGCGCTGTAAGAACTGG - Intronic
1185399347 22:50607912-50607934 GCCAGCTTCCCTCCAGGCACAGG + Intronic
1203284740 22_KI270734v1_random:149096-149118 TCCACCTGCCCTGGGAGAACAGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950668220 3:14509955-14509977 TCCAGCTCATCTGCAAGCACGGG + Exonic
951673897 3:25215544-25215566 TCCTGCTGCACTTCAACCACAGG - Intronic
952449250 3:33415886-33415908 TCCAGGTGCCCTCCAGGTACTGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953576129 3:44114428-44114450 TGCAGCTCCCCTGCAGACACTGG + Intergenic
953607496 3:44421203-44421225 TCTACCTTCCCTGGAAGCACAGG - Intergenic
953743091 3:45553686-45553708 GCCAGCTGCCCTCCAAGATCAGG - Intergenic
955462965 3:59205488-59205510 TTCAGCTGCCCTCCGTGCACAGG + Intergenic
955570812 3:60303528-60303550 TCCAGCTGCACTGAAGGCTCTGG - Intronic
959896977 3:111616833-111616855 TGCAGCTGCCCTGAAAGCCCAGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960989321 3:123300522-123300544 TACAGCTGCGCTGCAGGCCCAGG + Intronic
961057094 3:123798440-123798462 TCCAGCTCCCCTGAAAGCAAAGG - Intronic
961455661 3:127022694-127022716 TCCAGCTGTCCAGCAGGCACAGG - Intronic
961585820 3:127922615-127922637 TACAGCTGACCTGCAGGCAGAGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
965147748 3:164928083-164928105 CTCTGCTGCCCTGCAACCACAGG - Intergenic
966076051 3:175937471-175937493 GCCAGCTGCCCTGCCAGCCCCGG + Intergenic
967404036 3:189096406-189096428 TATAGCTGCTCTACAAGCACAGG - Intronic
968189134 3:196654793-196654815 TGCAGCTGCCCTTTAACCACAGG + Intronic
968371735 3:198226020-198226042 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
970607664 4:17695587-17695609 CCCAGCTGCACTGCCACCACAGG - Intronic
971250467 4:24969759-24969781 TCCAGCTCCCCTGAAAGCAGTGG + Intronic
973144285 4:46805121-46805143 TCGCGCTGGCCTCCAAGCACCGG + Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
975553888 4:75640576-75640598 TGGAGCTGCCATGCAAGCCCAGG + Intergenic
975689176 4:76948665-76948687 CCTCGCTGCCCTGCACGCACCGG + Intergenic
977889803 4:102296707-102296729 TCCAACTGCCTTGCAAGAAAAGG + Intronic
979260423 4:118638498-118638520 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
979296721 4:119041059-119041081 TCCAGCTGCCTTTCAAACCCAGG + Intronic
980822468 4:138035744-138035766 TTCAGCTGGCCTGCCAGCATTGG - Intergenic
980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981730279 4:147889710-147889732 CCCAGCTGCCCTCCCAACACAGG - Intronic
985685699 5:1280517-1280539 TCCAGGTGCCCTGCAAGTAGAGG - Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
990716605 5:58644425-58644447 TCCACCTACCATGCAGGCACGGG - Intronic
991725043 5:69527563-69527585 TCCAGCAGCCAAACAAGCACTGG - Intronic
992732884 5:79690081-79690103 GCTAGCTGCCCTGCAGGCCCTGG - Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995421971 5:111977885-111977907 TGCAGCTGTCTTGCAATCACTGG - Intronic
996315697 5:122158401-122158423 TCCAGCTGCTCTGTCAACACAGG + Intronic
997471674 5:134120723-134120745 TCCAGCTGCCTTGCCAGCCCTGG + Intronic
998080925 5:139274278-139274300 TTCAGATGCCCTCCAAGCTCGGG - Intronic
998752742 5:145340649-145340671 TCCAGCTACCCAGGAGGCACAGG + Intergenic
999008776 5:148011608-148011630 ACCAGCTTCTCTGGAAGCACAGG - Intergenic
1000965680 5:167653369-167653391 TCCAGCTGCTCTGGAAGCCAAGG - Intronic
1002336232 5:178480329-178480351 TCCTGCTGCCCTGGATCCACCGG + Intronic
1002601498 5:180356400-180356422 CCCTGCTCCCCTGTAAGCACAGG - Intergenic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1002730975 5:181331566-181331588 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1002753558 6:142538-142560 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1003193607 6:3895449-3895471 TTCAGCTCCCGTGTAAGCACAGG - Intergenic
1004653722 6:17637272-17637294 TCCAGCTGCACTGTAACCACTGG - Exonic
1005496568 6:26392875-26392897 TTCATCTGCCCTGCACTCACAGG + Exonic
1005505870 6:26468457-26468479 TTCATCTGCCCTGCACTCACAGG + Exonic
1006480058 6:34285132-34285154 TCCATCTGCCCTGCATGGAGAGG - Exonic
1008017073 6:46532467-46532489 TGCAGCTGGCCTACAAGAACAGG + Intergenic
1008092798 6:47309539-47309561 TCCAGCTGCCCCGCGCGCCCCGG - Exonic
1008169592 6:48186796-48186818 CACAGCTGCCCTGCACACACTGG + Intergenic
1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG + Intronic
1009901434 6:69812124-69812146 TCCAGATGGCTTGCAAGCAAGGG + Intergenic
1009929980 6:70165632-70165654 TCCAGCTGCACTGGAAGTCCAGG + Intronic
1012624860 6:101393231-101393253 ACCAGCAGCCCTCCAAGCCCTGG + Intergenic
1012759237 6:103277166-103277188 TCCAGCTGCCTTGCATGCTCTGG + Intergenic
1013796642 6:113896118-113896140 TTGAGCTGCCCTGGAAGCTCAGG + Intergenic
1015412750 6:132913317-132913339 TCCTGCAGCCCTGAAAGCACAGG - Intergenic
1017043308 6:150324897-150324919 CCCAGCTGTCCTCCCAGCACAGG - Intergenic
1017313078 6:152997383-152997405 TCCAGCTGATCTGCATGCAAAGG - Intronic
1017432625 6:154385918-154385940 TCCAGCTGCTCTGAAAGCTGAGG + Intronic
1017940237 6:159046413-159046435 TACAGCTGCCCTGGGAACACTGG - Intergenic
1018174462 6:161166912-161166934 TCCCGCTGCCCTGCAGGTGCTGG - Intronic
1018951590 6:168381833-168381855 TCCAGCAGCCCTGCTGGCAGTGG - Intergenic
1019666692 7:2255483-2255505 TCTAGCTGCCGTGCGGGCACTGG + Intronic
1020617647 7:10479263-10479285 TACAGCTGCCCTGCATGCTTTGG - Intergenic
1021415053 7:20374564-20374586 TCCAGTTGCCATGGAAACACAGG + Intronic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1023402140 7:39798098-39798120 TCCACCTGCCCTGAAAGCCCAGG - Intergenic
1024076121 7:45818728-45818750 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1024647483 7:51382562-51382584 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1024971132 7:55071525-55071547 TCCACCTGCCCTGCCTTCACTGG + Intronic
1025051317 7:55737057-55737079 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1025060083 7:55798312-55798334 GCCACCTGCCCTGAAAGCCCAGG + Intronic
1025128282 7:56362724-56362746 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1025143385 7:56484018-56484040 TCCAGCTGCCTTGCCACCAACGG - Intergenic
1025176664 7:56805605-56805627 GCCACCTGCCCTGAAAGCCCAGG + Intergenic
1025695128 7:63770781-63770803 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1026979033 7:74515899-74515921 TACACCTGCCCTGCAACCAAGGG + Intronic
1032052653 7:128658491-128658513 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1033049833 7:137994156-137994178 TTCAGATGCCCTGCAACCATAGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034803586 7:154068514-154068536 ACCAGCTGCCCTCCAAGGCCGGG - Intronic
1034879861 7:154755305-154755327 CCCAGCAGCCCAGCATGCACAGG + Intronic
1035012297 7:155729976-155729998 ACCAGCTGCCCACAAAGCACAGG - Intronic
1035048769 7:155986162-155986184 TCCAGCTGCCCAGCCAGGCCAGG + Intergenic
1036427344 8:8657010-8657032 TCCAGCTGCCTTGCTATCCCTGG - Intergenic
1036824733 8:11967207-11967229 ACCAGGTGTCCTGCAGGCACAGG + Intergenic
1037264696 8:17045611-17045633 TGCAGCTTCCCTGCCAGCCCGGG - Intronic
1037381895 8:18294068-18294090 ACCAGCTTCCCTGAAACCACAGG - Intergenic
1037719117 8:21427653-21427675 TCCAGCTTCTCTGCAAATACAGG - Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1038788841 8:30648718-30648740 TCCAGCTGCTCTGCCAGCCTGGG + Intronic
1042865768 8:73355735-73355757 TCCTGCTGCCCTCTGAGCACTGG - Intergenic
1043187430 8:77172399-77172421 TCTAGCTTTCCTACAAGCACAGG + Intergenic
1044725497 8:95191263-95191285 TCCAGCTCCGGTGCAGGCACTGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1048468395 8:134686078-134686100 TGCAGCTGCCCTGACAGCTCAGG + Intronic
1049600663 8:143505921-143505943 GCCAGCTGCCCTGCAGGGAGCGG - Intronic
1051854520 9:21548558-21548580 TCTGGATGCTCTGCAAGCACTGG - Intergenic
1055205779 9:73728649-73728671 TTCAGCTGCTCAGCAAGCTCTGG - Intergenic
1056295803 9:85191999-85192021 ACCAGCTGCCGTTCTAGCACTGG + Intergenic
1056395239 9:86175710-86175732 TCCAGATGCCCTTCCAACACTGG - Intergenic
1056824010 9:89864362-89864384 TCCAGCAACTCTGCAAGCCCAGG - Intergenic
1056852482 9:90096224-90096246 TGCAGATGCCCTCCAAGCCCTGG + Intergenic
1057772635 9:97982681-97982703 CCCAGCTGCCCTGCCAGGGCCGG + Intergenic
1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG + Intronic
1060278510 9:122199992-122200014 TCCATCTGCCCTACTAGCATTGG + Exonic
1060913103 9:127366463-127366485 TCCTGCTGCCCTGCATCCCCAGG + Intronic
1061204469 9:129155040-129155062 GCCAGCTGCCCTGCCAGGAGAGG - Intergenic
1062069400 9:134547423-134547445 GCCAGCTGCCCTGCACCCAAGGG - Intergenic
1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG + Intronic
1062755381 9:138284073-138284095 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1203579294 Un_KI270745v1:28245-28267 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1186334378 X:8570681-8570703 TCCATCTGCCCCACCAGCACCGG - Exonic
1186820161 X:13279829-13279851 TCCGGCTGCCCTTCAATGACAGG - Intergenic
1187710176 X:22045446-22045468 TCCAGCTGCCATGCAATTGCTGG - Intronic
1190756879 X:53408981-53409003 CCCAGCAGCCCTGTAAGGACAGG - Intronic
1190973821 X:55379708-55379730 CCCTGCTGCCCTGCCACCACTGG + Intergenic
1191654160 X:63577547-63577569 GCCAGCCTCCCTGCAGGCACTGG - Intergenic
1191714926 X:64187650-64187672 TCAAGCTGCCCTGAAAGAAGAGG + Exonic
1193399133 X:81021347-81021369 TGCAGCTGCTCTGGGAGCACAGG + Intergenic
1193638736 X:83985204-83985226 GCCAGCAGCCCTGCACCCACTGG + Intergenic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1196195302 X:112832950-112832972 TGCTGTTGCCTTGCAAGCACAGG + Intronic
1198233773 X:134717370-134717392 TCCAGCTACTCTGGAAGCAGAGG - Intronic
1200039077 X:153353079-153353101 TCCAAGTGCCCAGCAAGCACTGG - Intronic
1200283617 X:154800120-154800142 GACAGCTGCCCAGCAAGCCCTGG + Intronic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic
1202381901 Y:24280867-24280889 GCCACCTGCCCTGAAAGCCCAGG - Intergenic
1202488883 Y:25389258-25389280 GCCACCTGCCCTGAAAGCCCAGG + Intergenic