ID: 1037766321

View in Genome Browser
Species Human (GRCh38)
Location 8:21774548-21774570
Sequence GACCTCATTGGATTGCTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037766321_1037766330 15 Left 1037766321 8:21774548-21774570 CCTCGCAGCAATCCAATGAGGTC No data
Right 1037766330 8:21774586-21774608 CATCACAGCTGAGGAAACTGAGG No data
1037766321_1037766325 6 Left 1037766321 8:21774548-21774570 CCTCGCAGCAATCCAATGAGGTC No data
Right 1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG No data
1037766321_1037766331 25 Left 1037766321 8:21774548-21774570 CCTCGCAGCAATCCAATGAGGTC No data
Right 1037766331 8:21774596-21774618 GAGGAAACTGAGGCCCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037766321 Original CRISPR GACCTCATTGGATTGCTGCG AGG (reversed) Intronic