ID: 1037766321 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:21774548-21774570 |
| Sequence | GACCTCATTGGATTGCTGCG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037766321_1037766330 | 15 | Left | 1037766321 | 8:21774548-21774570 | CCTCGCAGCAATCCAATGAGGTC | No data | ||
| Right | 1037766330 | 8:21774586-21774608 | CATCACAGCTGAGGAAACTGAGG | No data | ||||
| 1037766321_1037766325 | 6 | Left | 1037766321 | 8:21774548-21774570 | CCTCGCAGCAATCCAATGAGGTC | No data | ||
| Right | 1037766325 | 8:21774577-21774599 | GTACTCCCCCATCACAGCTGAGG | No data | ||||
| 1037766321_1037766331 | 25 | Left | 1037766321 | 8:21774548-21774570 | CCTCGCAGCAATCCAATGAGGTC | No data | ||
| Right | 1037766331 | 8:21774596-21774618 | GAGGAAACTGAGGCCCAGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037766321 | Original CRISPR | GACCTCATTGGATTGCTGCG AGG (reversed) | Intronic | ||