ID: 1037766325

View in Genome Browser
Species Human (GRCh38)
Location 8:21774577-21774599
Sequence GTACTCCCCCATCACAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037766319_1037766325 15 Left 1037766319 8:21774539-21774561 CCACTTAGACCTCGCAGCAATCC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG No data
1037766317_1037766325 23 Left 1037766317 8:21774531-21774553 CCACTGACCCACTTAGACCTCGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG No data
1037766315_1037766325 27 Left 1037766315 8:21774527-21774549 CCACCCACTGACCCACTTAGACC 0: 1
1: 0
2: 0
3: 7
4: 184
Right 1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG No data
1037766324_1037766325 -6 Left 1037766324 8:21774560-21774582 CCAATGAGGTCGGTACGGTACTC 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG No data
1037766316_1037766325 24 Left 1037766316 8:21774530-21774552 CCCACTGACCCACTTAGACCTCG 0: 1
1: 0
2: 1
3: 2
4: 46
Right 1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG No data
1037766321_1037766325 6 Left 1037766321 8:21774548-21774570 CCTCGCAGCAATCCAATGAGGTC 0: 1
1: 0
2: 0
3: 28
4: 216
Right 1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG No data
1037766318_1037766325 16 Left 1037766318 8:21774538-21774560 CCCACTTAGACCTCGCAGCAATC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037766325 Original CRISPR GTACTCCCCCATCACAGCTG AGG Intronic
No off target data available for this crispr