ID: 1037766331

View in Genome Browser
Species Human (GRCh38)
Location 8:21774596-21774618
Sequence GAGGAAACTGAGGCCCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037766324_1037766331 13 Left 1037766324 8:21774560-21774582 CCAATGAGGTCGGTACGGTACTC No data
Right 1037766331 8:21774596-21774618 GAGGAAACTGAGGCCCAGACAGG No data
1037766326_1037766331 -9 Left 1037766326 8:21774582-21774604 CCCCCATCACAGCTGAGGAAACT No data
Right 1037766331 8:21774596-21774618 GAGGAAACTGAGGCCCAGACAGG No data
1037766321_1037766331 25 Left 1037766321 8:21774548-21774570 CCTCGCAGCAATCCAATGAGGTC No data
Right 1037766331 8:21774596-21774618 GAGGAAACTGAGGCCCAGACAGG No data
1037766327_1037766331 -10 Left 1037766327 8:21774583-21774605 CCCCATCACAGCTGAGGAAACTG No data
Right 1037766331 8:21774596-21774618 GAGGAAACTGAGGCCCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037766331 Original CRISPR GAGGAAACTGAGGCCCAGAC AGG Intronic