ID: 1037770987

View in Genome Browser
Species Human (GRCh38)
Location 8:21799693-21799715
Sequence AACAAGTGACTTGGTTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037770987_1037770991 -3 Left 1037770987 8:21799693-21799715 CCTAGTGAACCAAGTCACTTGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1037770991 8:21799713-21799735 GTTAGTCTGAAGAAACAAAGGGG No data
1037770987_1037770993 29 Left 1037770987 8:21799693-21799715 CCTAGTGAACCAAGTCACTTGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1037770993 8:21799745-21799767 TCAAGCTAATCCCCCTGAAGTGG No data
1037770987_1037770990 -4 Left 1037770987 8:21799693-21799715 CCTAGTGAACCAAGTCACTTGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1037770990 8:21799712-21799734 TGTTAGTCTGAAGAAACAAAGGG No data
1037770987_1037770989 -5 Left 1037770987 8:21799693-21799715 CCTAGTGAACCAAGTCACTTGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1037770989 8:21799711-21799733 TTGTTAGTCTGAAGAAACAAAGG No data
1037770987_1037770994 30 Left 1037770987 8:21799693-21799715 CCTAGTGAACCAAGTCACTTGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037770987 Original CRISPR AACAAGTGACTTGGTTCACT AGG (reversed) Intronic
902974946 1:20081694-20081716 AACCAGTGCCTTGGTACACCCGG - Intronic
905680029 1:39863894-39863916 TTCAAGTGATTTTGTTCACTGGG + Intronic
909251914 1:73368714-73368736 AATAAGGTACTTGTTTCACTGGG + Intergenic
913192695 1:116426745-116426767 AACAAGCGACTTGGATTTCTAGG + Intergenic
917068721 1:171125853-171125875 ACCAAGGGACTTGCTTCAGTAGG + Intergenic
918989284 1:191677109-191677131 AATTAGTGACTTTGTTAACTAGG - Intergenic
919727709 1:200894874-200894896 AACAAGTAACCTGGTTCCCCTGG + Exonic
921473904 1:215582451-215582473 AACCAGAGGGTTGGTTCACTAGG + Intronic
923614731 1:235527432-235527454 AGCAAGTGACTTGTTTGGCTAGG + Intergenic
924781423 1:247151985-247152007 AATAAGTGACTGGGATCACAAGG + Intronic
1063867850 10:10386304-10386326 AAAATGTGACTTGGTCCAGTTGG + Intergenic
1066634704 10:37489205-37489227 ACCCAGTGGCTTGGTTAACTGGG + Intergenic
1067898527 10:50212898-50212920 ATCCATTGACTTGGTTCATTAGG - Intronic
1070303672 10:75224571-75224593 TCCAAGGGAGTTGGTTCACTGGG + Intronic
1070390074 10:75962245-75962267 AGCAAGTCACTTGTTTCTCTGGG + Intronic
1071879659 10:89882557-89882579 AAAAAGTCACTGGGTTCATTGGG + Intergenic
1073080719 10:100858876-100858898 AACGAGTGCCTTGGTTGACATGG - Intergenic
1078164133 11:8868170-8868192 AGCGAGTAGCTTGGTTCACTGGG - Intronic
1078612086 11:12829721-12829743 AACACCTGACTGAGTTCACTGGG - Intronic
1087429928 11:98040854-98040876 AACAATAAACTTGGTTCAATAGG + Intergenic
1087729364 11:101760742-101760764 AGCATGTGTCTTGGTCCACTTGG + Intronic
1090130219 11:124134408-124134430 AAGAAGTTACTTGGTGCACATGG + Intronic
1098322799 12:69264413-69264435 AACAATGGACTTTGTTTACTTGG - Intronic
1099851499 12:88102840-88102862 AACAAGTAACTTGGAACACCTGG - Exonic
1105758438 13:23491339-23491361 CACCAGTGACTTGATCCACTTGG - Intergenic
1108827441 13:54431876-54431898 CACAAATGATTTGGTTAACTTGG - Intergenic
1110011720 13:70344213-70344235 AAGAAGTGACTTTGCTGACTTGG - Intergenic
1110623000 13:77620241-77620263 AAAAAGTGACTTCATTCAATTGG + Intronic
1110699837 13:78534125-78534147 AAGAAGGGACTTGGATCAATTGG - Intergenic
1113796154 13:113059915-113059937 GACAAGTGTCTTGGTTTCCTGGG + Intronic
1124143859 15:27102640-27102662 AACAAGTTACTTTCTTCACTAGG + Intronic
1134604239 16:15557702-15557724 AACAACTGACTTGGTTTGCCTGG - Intronic
1136776959 16:32877140-32877162 AACAGGTGCCTTGTGTCACTTGG - Intergenic
1136893658 16:33984373-33984395 AACAGGTGCCTTGTGTCACTTGG + Intergenic
1137846064 16:51689442-51689464 AATAAATGTATTGGTTCACTTGG + Intergenic
1138485475 16:57340162-57340184 AAAAAGTGACTGGGTGCACTGGG - Intergenic
1141371560 16:83491197-83491219 AAATAGTGTCTTGGTCCACTGGG + Intronic
1203079375 16_KI270728v1_random:1139249-1139271 AACAGGTGCCTTGTGTCACTTGG - Intergenic
1142505278 17:359155-359177 AATCAGTGACGTGGTTCACGTGG - Intronic
1146478761 17:33185370-33185392 AAAAAGTGACTTGGTGCACACGG + Intronic
1147299458 17:39513284-39513306 AAGAAGTGATTTGCTCCACTGGG - Intronic
1152447616 17:80355157-80355179 AACCAGTGACTTGGTTATTTGGG + Intronic
1152575359 17:81137622-81137644 AACAAGTGTCATGGTTCCCAGGG - Intronic
1154013361 18:10594488-10594510 ACCTAGTGTCTTGGTTCATTTGG - Intergenic
1158255624 18:55545387-55545409 AACAAGTGAATGGGATAACTTGG - Intronic
1159072715 18:63644008-63644030 TAAAAGTGCCTTGGTTTACTTGG + Intronic
1159074160 18:63661645-63661667 TAAAAGTGCCTTGGTTTACTTGG + Intronic
1159650998 18:70978789-70978811 AAGAAGTCACTTGTTTCCCTGGG - Intergenic
1164632107 19:29768651-29768673 AACAAGTGACGTGATGCACAGGG + Intergenic
1166599559 19:44081992-44082014 AGCATGTGACTTTGTTCACAGGG + Exonic
1166860525 19:45807997-45808019 AATAAGTGACTTGGATGAGTTGG - Intronic
926773739 2:16401855-16401877 AGAACGTGGCTTGGTTCACTGGG + Intergenic
940965194 2:159829379-159829401 AAAAAGTCACTTTTTTCACTTGG + Intronic
941592082 2:167432362-167432384 AACAAGACAATTGGTTCACCTGG + Intergenic
942764177 2:179434324-179434346 AACAAGTGAATTGATTCCCAGGG + Intergenic
944051065 2:195470484-195470506 AACAAGTGGCTTGGTTTCATAGG - Intergenic
1169820089 20:9700856-9700878 AACAAGTGACCTGATTTTCTGGG - Intronic
1170796043 20:19547586-19547608 CACAGGTGACTGCGTTCACTCGG + Intronic
1172806010 20:37612370-37612392 AACAAATCACTTGCTTCTCTGGG - Intergenic
1175038479 20:56022815-56022837 AACAAGGGACATGGCTCACGTGG - Intergenic
1176909972 21:14552679-14552701 AACAGGTGACTTAGTCCATTTGG - Intronic
1181755969 22:25025094-25025116 ACCAAGTGATGTGCTTCACTTGG - Intronic
1181755971 22:25025125-25025147 ACCAAGTGATGTGCTTCACTTGG - Intronic
1181761349 22:25060743-25060765 AACCAGTGCCTTGTTTCACCTGG - Intronic
1183897116 22:40978274-40978296 AACGAGTCACTTAGTTCTCTGGG - Intergenic
1184358927 22:44002134-44002156 ACTTAGTTACTTGGTTCACTGGG - Intronic
951927720 3:27926744-27926766 AAGCAGTGACTTATTTCACTGGG + Intergenic
952656430 3:35791858-35791880 AGCAAGTCATTTGGTTCACTAGG + Intronic
953013527 3:39051605-39051627 AGTAAATCACTTGGTTCACTTGG + Intergenic
953444934 3:42955140-42955162 AACAAGTGGCTTGCCTCAGTAGG + Intronic
953555984 3:43947409-43947431 ACCAGGTGACTTAGTTCACCGGG - Intergenic
955693970 3:61617124-61617146 ACCATGTGACTTGTTTCAGTTGG - Intronic
957594726 3:82248226-82248248 CACAACTAACTTGTTTCACTTGG - Intergenic
969150845 4:5167290-5167312 AACAAGTTAATTAGTACACTTGG + Intronic
970080557 4:12279715-12279737 AACCTGTGATTTGGTTCACAAGG - Intergenic
970080640 4:12280896-12280918 AACATGTGATTTGTTTCTCTGGG - Intergenic
971790797 4:31167694-31167716 AGCAAGTGATTTGGTGGACTAGG - Intergenic
978148295 4:105403849-105403871 AACAAGTGAATTGGTTTATATGG - Intronic
979677840 4:123429177-123429199 AAAAATTGACTTGGGTTACTAGG + Intergenic
980797640 4:137705371-137705393 GAAAAGTGACTTGATTCACAGGG + Intergenic
984012474 4:174386862-174386884 ACCATGTGGCTTGGTTCACAAGG + Intergenic
987188457 5:15449318-15449340 AACAAGAGACTGGAGTCACTGGG + Intergenic
987693099 5:21293836-21293858 GACAAGTGACTTGATAAACTAGG - Intergenic
990384144 5:55242970-55242992 ACTAAGTGACTTGTTTCAGTGGG + Intergenic
990949818 5:61287528-61287550 AGCAAGTGACTTCCTTCTCTGGG + Intergenic
991178955 5:63726135-63726157 AACAGGAGACTATGTTCACTTGG - Intergenic
991747180 5:69755716-69755738 GACAAGTGACTTGATAAACTAGG + Intergenic
991750525 5:69799526-69799548 GACAAGTGACTTGATAAACTAGG - Intergenic
991798782 5:70335654-70335676 GACAAGTGACTTGATAAACTAGG + Intergenic
991826556 5:70631029-70631051 GACAAGTGACTTGATAAACTAGG + Intergenic
991829813 5:70674427-70674449 GACAAGTGACTTGATAAACTAGG - Intergenic
991891113 5:71334981-71335003 GACAAGTGACTTGATAAACTAGG + Intergenic
991953052 5:71965459-71965481 AACCAGGGACTTGGCTCTCTTGG - Intergenic
999529043 5:152441541-152441563 AACAATTGCTTTGGTTCCCTTGG - Intergenic
1001616997 5:173050589-173050611 AACAGCTGACTTCCTTCACTTGG + Intergenic
1004960128 6:20778867-20778889 AACATTTGAATTGGTACACTGGG - Intronic
1005310670 6:24556046-24556068 ACCAAGTGAGCTGGTTCACTTGG + Intronic
1007588311 6:43006441-43006463 AACAGGTGACTTGTTTGACCAGG + Exonic
1010524270 6:76881086-76881108 TAAAAGTGAGTTGGTTCAGTGGG - Intergenic
1010539715 6:77076360-77076382 AACCAGTGACTGGCTCCACTGGG + Intergenic
1013237597 6:108211168-108211190 AACAAGTCACTCAGTTGACTAGG + Intergenic
1016537866 6:145128327-145128349 AACAAATGATCTGTTTCACTTGG + Intergenic
1018152645 6:160954814-160954836 AACAAGTGAATGAGTTCATTGGG + Intergenic
1018301860 6:162411252-162411274 AAGAAGTGACTAGGTTAATTAGG + Intronic
1020779090 7:12495631-12495653 AACAAGAGACTTTCTTTACTTGG - Intergenic
1021190400 7:17613473-17613495 ACCCAGAGCCTTGGTTCACTTGG + Intergenic
1023674427 7:42615483-42615505 AAGAAGTGACTACGTTCAGTAGG - Intergenic
1026291513 7:69010584-69010606 AACATGTAACTTGGTTCATTAGG - Intergenic
1027962424 7:84963640-84963662 ACCAAGTGCCTTGGTTTACCAGG + Intergenic
1032156320 7:129471721-129471743 GACAAGTCACTTCATTCACTGGG - Intronic
1033711580 7:143951519-143951541 AAAAATTGGCTTGGTTCACCAGG + Intergenic
1033774975 7:144599418-144599440 AACATGTGCCTTGGTTTACATGG - Intronic
1037721685 8:21449787-21449809 ATCTAGTGACTTGGGCCACTGGG + Intergenic
1037770987 8:21799693-21799715 AACAAGTGACTTGGTTCACTAGG - Intronic
1038258153 8:25970040-25970062 ACCAAGTCACTTGCTTCTCTGGG - Intronic
1041684388 8:60629395-60629417 AACAAATGTCTTTGTTCACAGGG - Intergenic
1041821744 8:62043591-62043613 AACACCTGACATGATTCACTGGG - Intergenic
1044548100 8:93481887-93481909 AGGAAGTGACTTGGTTTTCTTGG - Intergenic
1046015777 8:108603480-108603502 AAGAGGTGACTTGGGTCATTAGG - Intergenic
1048260050 8:132937513-132937535 ATCTAGTGACTAGGGTCACTCGG + Intronic
1051782847 9:20709197-20709219 AACAACTGTTTTGATTCACTGGG + Intronic
1055768158 9:79687595-79687617 GACAAGGGACTTGCTTCATTAGG - Intronic
1061934800 9:133851479-133851501 ATGAGCTGACTTGGTTCACTCGG - Intronic
1185538717 X:884860-884882 AACGACTCACTTGGCTCACTTGG - Intergenic
1186372184 X:8958634-8958656 AAGAGTTAACTTGGTTCACTTGG - Intergenic
1186725312 X:12351344-12351366 AACACGTGACTTGGTTCTTTAGG + Intronic
1186995378 X:15115815-15115837 AACAAGTTAGTTAGTTCACCTGG - Intergenic
1189634151 X:42987255-42987277 AACAAGTGAAGAGCTTCACTAGG + Intergenic
1191244778 X:58218433-58218455 AACATGTGATTTGATTCACCAGG + Intergenic
1196053935 X:111334886-111334908 AACCAGTGACTAGGGTCATTTGG - Intronic
1198611659 X:138408092-138408114 AATAAGTGAATTGATTCAATGGG - Intergenic
1199712564 X:150480660-150480682 ACCAAGAAACTTGGTTCACATGG - Intronic
1200102905 X:153696906-153696928 AACAGGTGCCTTGTGTCACTTGG + Intergenic