ID: 1037770988

View in Genome Browser
Species Human (GRCh38)
Location 8:21799702-21799724
Sequence CTTCAGACTAACAAGTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1036
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 1011}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037770988_1037770993 20 Left 1037770988 8:21799702-21799724 CCAAGTCACTTGTTAGTCTGAAG 0: 1
1: 0
2: 0
3: 24
4: 1011
Right 1037770993 8:21799745-21799767 TCAAGCTAATCCCCCTGAAGTGG No data
1037770988_1037770996 30 Left 1037770988 8:21799702-21799724 CCAAGTCACTTGTTAGTCTGAAG 0: 1
1: 0
2: 0
3: 24
4: 1011
Right 1037770996 8:21799755-21799777 CCCCCTGAAGTGGGAGATGAAGG No data
1037770988_1037770994 21 Left 1037770988 8:21799702-21799724 CCAAGTCACTTGTTAGTCTGAAG 0: 1
1: 0
2: 0
3: 24
4: 1011
Right 1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037770988 Original CRISPR CTTCAGACTAACAAGTGACT TGG (reversed) Intronic
900223451 1:1521813-1521835 CCTCAGCCTCCCAAGTGACTGGG + Intronic
901108176 1:6773883-6773905 CCTCAGACTCCCAAGTGGCTGGG - Intergenic
901359527 1:8684971-8684993 CTTCAGTCTTCCAAGTAACTGGG + Intronic
901585486 1:10287310-10287332 CTTCAGCCTCCCAAGTAACTGGG + Intronic
901869573 1:12130018-12130040 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
902248626 1:15138679-15138701 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
902427977 1:16339837-16339859 CCTCAGACTCACAAGTAGCTGGG - Intronic
902644175 1:17786808-17786830 CCTCAGACTCCCAAGTAACTGGG + Intronic
903086890 1:20869191-20869213 CTTCAGACTAGCACATGATTTGG - Intronic
903246746 1:22021783-22021805 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
903622076 1:24705163-24705185 CTTCAGTCTCCCAAGTGGCTGGG + Intergenic
903689431 1:25161245-25161267 CCTCAGACTCTCAAGTAACTTGG - Intergenic
903866896 1:26405859-26405881 CCTCAGACTACCAAGTAGCTGGG - Intergenic
904063373 1:27728466-27728488 CCTCAGCCTACCAAGTAACTGGG + Intronic
904151984 1:28449206-28449228 CTTCAGCCTCTCAAGTCACTGGG - Intronic
904174279 1:28614991-28615013 CTTCAGCCTCCCAAGTAACTGGG - Intronic
905776793 1:40673062-40673084 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
906134014 1:43482660-43482682 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
906254996 1:44341772-44341794 CTTCAGCCTACCAAGTAGCTGGG - Intronic
906450107 1:45938437-45938459 CCTCAGCCTCCCAAGTGACTGGG + Intronic
906497067 1:46312209-46312231 CTTCAGCCTCCCAAGTAACTGGG + Intronic
907226741 1:52954447-52954469 CCTCAGCCTACCAAGTCACTAGG + Intronic
907229107 1:52978676-52978698 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
907338781 1:53718777-53718799 CTTGGGACTAAAAAGTGTCTCGG - Intronic
907626030 1:56030514-56030536 CCTCAGCCTACCAAGTAACTGGG - Intergenic
908460273 1:64342273-64342295 CTTCAGCCTCCCGAGTGACTGGG + Intergenic
908494884 1:64684923-64684945 CTTCAGCCTCCCAAGTAACTGGG + Intronic
908598473 1:65712749-65712771 CCTCAGCCTACCAAGTGGCTGGG - Intergenic
908695998 1:66842504-66842526 CTTCAGCCTAATAAGTAGCTGGG + Intronic
908812660 1:67999731-67999753 CTTCAGCCTACCAAGTAGCTGGG + Intergenic
909063966 1:70910522-70910544 CCTCAGTCTCCCAAGTGACTGGG + Intronic
909254727 1:73405878-73405900 CTTCAGCCTTACAAGTAGCTGGG + Intergenic
909665611 1:78128887-78128909 CCTCAGACTCTCAAGTGGCTAGG - Intronic
910308690 1:85798079-85798101 CCTCAGATTCACAAGTAACTGGG - Intronic
910584306 1:88862424-88862446 CTTCAGCCTCCCAAGTAACTGGG - Intronic
910983769 1:92984233-92984255 CTTCAGTCTCACAAGTAGCTGGG - Intergenic
912657348 1:111498973-111498995 CCTCAGCCTCCCAAGTGACTGGG - Intronic
912734975 1:112142692-112142714 CTCCGGACTAGCAAGTGAATAGG - Intergenic
913964131 1:143361041-143361063 CTTCAGCCTACCAAGTAGCTGGG + Intergenic
914045573 1:144089120-144089142 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
914058496 1:144186644-144186666 CTTCAGCCTACCAAGTAGCTGGG + Intergenic
914120652 1:144779727-144779749 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
914132537 1:144871566-144871588 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
914228766 1:145745328-145745350 CCTCAGCCTACCAAGTGGCTGGG - Exonic
914262796 1:146013155-146013177 CTAGTGACTAAAAAGTGACTTGG - Intergenic
914894166 1:151653631-151653653 CTTCAGCCTACCAAGTAGCTGGG + Intronic
915383270 1:155463677-155463699 CTTCAGCCTCCCAAGTAACTGGG - Intronic
915391969 1:155551858-155551880 CTTCAGCCTCCCAAGTCACTGGG - Intronic
915657769 1:157375980-157376002 CCTCAGCCTACCAAGTAACTAGG + Intergenic
915945442 1:160147107-160147129 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
916166158 1:161968992-161969014 CCTCAGCCTACCAAGTGGCTGGG - Intergenic
916306924 1:163346737-163346759 CCTCAGACTCCCAAGTGGCTGGG - Intronic
916537242 1:165714852-165714874 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
916792033 1:168133709-168133731 CCTCAGCCTATCAAGTAACTGGG + Intronic
917197897 1:172485644-172485666 CATTTGACTAACAAATGACTAGG - Intergenic
917383538 1:174441616-174441638 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
918087909 1:181261007-181261029 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
918096362 1:181338199-181338221 CCTCAGGCTAACAAGTAGCTGGG + Intergenic
918251326 1:182706096-182706118 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
918261370 1:182799645-182799667 CTTCAGCCTCCCAAGTAACTGGG - Intronic
918291642 1:183114183-183114205 CCTCAGCCTACCAAGTGGCTGGG + Intronic
918921954 1:190724124-190724146 CCTCAGACTACCAAGTAGCTGGG + Intergenic
920063853 1:203250175-203250197 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
920092226 1:203462954-203462976 CTTCAGCCTCCCAAGTGGCTAGG - Intergenic
920124950 1:203686807-203686829 CTTCAGACTCCCAAGTAGCTAGG + Intronic
920162961 1:204013793-204013815 CTTCAGCCTTACAAGTAGCTGGG - Intergenic
920321610 1:205127804-205127826 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
920378304 1:205521325-205521347 CTTCAGCCTCCCAAGTAACTGGG + Intronic
920885468 1:209923660-209923682 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
920927885 1:210359749-210359771 CCTCAGACTCTCAAGTGGCTGGG - Intronic
921020784 1:211233829-211233851 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
921228861 1:213048510-213048532 CTTCAGCCTCCCAAGTGACTGGG + Intergenic
921250929 1:213297390-213297412 GTTCAGATTCACAAGTGACTAGG - Intergenic
921570752 1:216775665-216775687 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
922498256 1:226077608-226077630 CCTCAGCCTTCCAAGTGACTGGG - Intergenic
922712329 1:227843584-227843606 CTTCAGACTCCCAAGTAGCTGGG - Intronic
923709580 1:236376048-236376070 CTTCAGCCTCCCAAGTGACTGGG + Intronic
924156201 1:241179208-241179230 CTTCAGCCTTCCAAGTAACTGGG + Intronic
924823772 1:247518871-247518893 CTTCAGCCTCCCAAGTAACTAGG - Intronic
1063144717 10:3286312-3286334 CCTCAGCCTAACACGTGGCTGGG - Intergenic
1063440029 10:6065391-6065413 CTTCAGCCTCTCAAGTAACTGGG + Intergenic
1063455090 10:6177639-6177661 CCTCAGCCTAACAAGTAGCTGGG + Intronic
1064443985 10:15377466-15377488 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1064471129 10:15637027-15637049 CCTCAGACTCCCAAGTAACTGGG - Intronic
1064499107 10:15949479-15949501 CTTCAGAATAGCAAAAGACTGGG - Intergenic
1064503071 10:15995815-15995837 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1064576857 10:16755236-16755258 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1064734951 10:18372520-18372542 CTTCAGCCTACCAAGTAACTGGG + Intronic
1065048934 10:21770511-21770533 CCTCAGCCTCACAAGTAACTGGG + Intronic
1065203150 10:23332566-23332588 CTTCAGCCTCACAAGTAGCTGGG - Intronic
1065349444 10:24782508-24782530 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1065365953 10:24937183-24937205 CATCAGACTAAAAAGTTACAGGG - Exonic
1065653622 10:27922049-27922071 CCTCAGCCTACCAAGTGCCTGGG - Intronic
1065695120 10:28372652-28372674 CCTCAGCCTTACAAGTGGCTAGG - Intergenic
1065732310 10:28720853-28720875 CCTCAGCCTACCAAGTGGCTGGG + Intergenic
1066124228 10:32324049-32324071 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1066516418 10:36165836-36165858 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1066548830 10:36532820-36532842 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1066998716 10:42586552-42586574 CTTCAGATTAACTATTAACTGGG + Intronic
1067094388 10:43289202-43289224 CTTCAGCCTACCAAGTGGCTGGG - Intergenic
1068032073 10:51716806-51716828 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1068143231 10:53031189-53031211 CCTCAGCCTAACAAGTAGCTGGG - Intergenic
1068548586 10:58380770-58380792 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1068680735 10:59817294-59817316 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1068821973 10:61387903-61387925 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1068976299 10:63013647-63013669 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1069004596 10:63303419-63303441 CTTCAGCCTCACAAGTAGCTGGG + Intronic
1069149084 10:64932733-64932755 CTTCAGCCTCACGAGTGCCTGGG - Intergenic
1069277918 10:66615998-66616020 CTCCACTTTAACAAGTGACTTGG - Intronic
1069338153 10:67377993-67378015 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1069350991 10:67527139-67527161 CCTCAGCCTCACAAGTAACTGGG - Intronic
1069423858 10:68272290-68272312 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1069546338 10:69331758-69331780 CCTCAGACTCCCAAGTGGCTGGG - Intronic
1069550219 10:69358930-69358952 CTTCAGCCTCTCAAGTAACTGGG - Intronic
1070922640 10:80197806-80197828 CCTCAGACTCACAAGTAGCTGGG - Intronic
1071496753 10:86173151-86173173 CTTCAGCCTACCAAGTAGCTGGG + Intronic
1072021056 10:91402092-91402114 CCTCAGTCTCCCAAGTGACTGGG - Intergenic
1072216554 10:93292008-93292030 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1072398462 10:95070449-95070471 CTTCAGAGTAACTAATGTCTGGG - Intergenic
1072463326 10:95640455-95640477 CTTCAGCCTACCAAGTAGCTAGG + Intronic
1072560445 10:96568539-96568561 CTCCAGGCTAACAATTGAATAGG + Intronic
1072865028 10:99050184-99050206 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1072907278 10:99465883-99465905 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1073014699 10:100388625-100388647 CTTCAGCCTCACAAGTAGCTAGG - Intergenic
1073351544 10:102823374-102823396 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1073400365 10:103251966-103251988 CTTCAGCCTTCCAAGTAACTAGG + Intergenic
1073456536 10:103640197-103640219 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1074014838 10:109523854-109523876 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1074519800 10:114208887-114208909 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1074522289 10:114236768-114236790 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1074562548 10:114546894-114546916 CCTCAGACTCACAAGTAGCTGGG + Intronic
1074628347 10:115219785-115219807 CCTCAGACCAACAAGTAGCTGGG - Intronic
1075029490 10:119012534-119012556 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1075438850 10:122463615-122463637 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1076295943 10:129384475-129384497 CCTCAGACTAGCAAGTAGCTGGG - Intergenic
1076574806 10:131457518-131457540 CCTCTGTCTGACAAGTGACTTGG - Intergenic
1077067513 11:649304-649326 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1077155179 11:1087908-1087930 CCTCAGACCAGCCAGTGACTGGG + Intergenic
1077401605 11:2360872-2360894 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1077621478 11:3728621-3728643 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1077636549 11:3845683-3845705 CCTCAGCCTAGCAAGTAACTGGG - Intergenic
1077926350 11:6685338-6685360 CCTCAGCCTCACAAGTAACTGGG + Intergenic
1078247156 11:9584249-9584271 CCTCAGACTCACAAGTAGCTGGG + Intronic
1079001418 11:16760246-16760268 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1079120353 11:17679333-17679355 CTTCAGCCTACCAAGTAGCTGGG + Intergenic
1079397934 11:20082076-20082098 TTTCTGAGTAACAAGTGACATGG + Intronic
1079410774 11:20185324-20185346 CCTCAGACTCCCAAGTGGCTGGG - Intergenic
1079616986 11:22507148-22507170 CTTCAGACTTTCAAGTAGCTGGG + Intergenic
1080521258 11:33069719-33069741 CTTCAGACTCCCAAGTAGCTGGG + Intronic
1080530094 11:33166002-33166024 CCTCAGCCTCCCAAGTGACTAGG + Intergenic
1080618788 11:33968870-33968892 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1081755701 11:45542817-45542839 CTTCAGACTCCCAAGTAGCTGGG - Intergenic
1082012176 11:47457542-47457564 CTTCAGCCTCCCAAGTGGCTTGG + Intergenic
1082017731 11:47504460-47504482 CTTCAGCCTCACAAGTAGCTGGG - Intronic
1082057272 11:47829419-47829441 CCTCAGCCTCACAAGTAACTGGG + Intronic
1083245297 11:61422427-61422449 CTTCAGTCTCCCAAGTAACTGGG + Intronic
1083565770 11:63714626-63714648 CTCCAGCCTCCCAAGTGACTGGG + Intronic
1083606921 11:63984498-63984520 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1083824776 11:65193843-65193865 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1084333422 11:68443372-68443394 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1085368003 11:75970615-75970637 CCTCAGCCTCACAAGTAACTGGG - Intronic
1085671425 11:78468095-78468117 CTTCAGCCTGCCAAGTAACTGGG - Intronic
1085903758 11:80734588-80734610 GTTCAGAGAAAGAAGTGACTTGG - Intergenic
1086101935 11:83109899-83109921 CTTCAGCCTCTCAAGTAACTGGG + Intergenic
1086202984 11:84225924-84225946 CCTCAGCCTAACAAGTAGCTGGG + Intronic
1086408517 11:86520301-86520323 CTTGAGATTAACAAGTGCTTAGG + Intronic
1087040318 11:93792823-93792845 CTTCAGCCTCCCAAGTAACTAGG - Intronic
1087868243 11:103260733-103260755 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1088285281 11:108181347-108181369 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1088298581 11:108329225-108329247 ATTCAGACAAACAGGTAACTAGG + Exonic
1088484384 11:110326669-110326691 CCTCAGCCTCACAAGTAACTGGG - Intergenic
1088652030 11:111966336-111966358 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1089231345 11:116979729-116979751 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1089238565 11:117054019-117054041 CTTCAGACTCCCAAGTAGCTAGG + Intronic
1089273792 11:117319684-117319706 CCTCAGACTCCCAAGTGGCTTGG - Intronic
1089763036 11:120742228-120742250 CCTCAGCCTCCCAAGTGACTGGG - Intronic
1090021811 11:123135142-123135164 CCTCAGCCTCACAAGTAACTGGG - Intronic
1090098935 11:123773486-123773508 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
1090611559 11:128475665-128475687 CCTCAGCCTACCAAGTGGCTGGG + Intronic
1092224659 12:6739938-6739960 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1092573846 12:9756962-9756984 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1092664106 12:10775189-10775211 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1092839838 12:12529225-12529247 CTTCAGTCTCCCAAGTAACTGGG + Intronic
1092875526 12:12844192-12844214 CTTCAGACTCCCAAGTTGCTGGG + Intergenic
1093386339 12:18559957-18559979 CCTCAGCCTCACAAGTAACTGGG + Intronic
1093589070 12:20877996-20878018 CTTCATAATAAAATGTGACTTGG - Intronic
1093907161 12:24706816-24706838 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1094014564 12:25848962-25848984 CCTCAGACTCCCCAGTGACTGGG - Intergenic
1094161652 12:27397184-27397206 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1095039968 12:37430528-37430550 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1095123718 12:38449318-38449340 ATGCAGAATAACAAGTGACTGGG + Intergenic
1095803593 12:46294153-46294175 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
1096150971 12:49312355-49312377 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1096515835 12:52154826-52154848 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1097259293 12:57706731-57706753 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1097413071 12:59279675-59279697 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1097675293 12:62595257-62595279 CTTCAGACTTCCAAGTAGCTGGG + Exonic
1097798327 12:63886987-63887009 CTTCAGTCTACCAAGTAGCTGGG + Intronic
1097879810 12:64676585-64676607 CCTCAGACTCACAAGTAGCTAGG + Intronic
1097943455 12:65338959-65338981 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1098068516 12:66646506-66646528 CTTCAGCCTCCCAAGTCACTGGG - Intronic
1098106899 12:67077251-67077273 CCTCAGACTCCCAAGTGGCTGGG - Intergenic
1099203672 12:79703876-79703898 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1099583929 12:84491122-84491144 CCTCAGACTCTCAAGTAACTGGG - Intergenic
1099626682 12:85084808-85084830 CCTCAGCCTACCAAGTAACTGGG - Intronic
1100117442 12:91324708-91324730 CTTCAGTCTCCCAAGTAACTAGG + Intergenic
1100129553 12:91474578-91474600 CCTCAGACTCCCAAGTCACTGGG + Intergenic
1100185021 12:92129369-92129391 CTTCAGCCTCCCGAGTGACTGGG - Intronic
1100549390 12:95633012-95633034 CTTCAGCCTTCCAAGTAACTAGG + Intergenic
1101344145 12:103869736-103869758 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1101403021 12:104404653-104404675 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1101538107 12:105639195-105639217 CTTCAGCCTCCCAAGTAACTAGG + Intergenic
1101554670 12:105797862-105797884 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1101856253 12:108445758-108445780 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1101981703 12:109413087-109413109 CTTCAGCCTCACAAGTAGCTGGG + Intronic
1102103181 12:110297317-110297339 CTGCAGCCTCACAAGTGGCTGGG - Intronic
1102725966 12:115065180-115065202 CTTCAGCCTACCAAGTTGCTGGG - Intergenic
1103071066 12:117942602-117942624 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1103075807 12:117981679-117981701 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1103098956 12:118155850-118155872 CTTCAGCCTCCCAAGTTACTGGG + Intronic
1103113195 12:118300889-118300911 CCTCAGACTCTCAAGTAACTGGG + Intronic
1103294152 12:119871739-119871761 CCTCAGTCTCACAAGTGGCTAGG - Intronic
1103365913 12:120383164-120383186 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1103397267 12:120617713-120617735 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1103591839 12:121997026-121997048 CTCGAGAGCAACAAGTGACTGGG + Intronic
1103707052 12:122881357-122881379 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1103792995 12:123484770-123484792 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1104022143 12:124999731-124999753 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1104047812 12:125175383-125175405 CTTTGGACTATAAAGTGACTTGG + Intergenic
1104126779 12:125854827-125854849 CCTCAGACTCCCAAGTAACTGGG + Intergenic
1104338324 12:127922290-127922312 CCTCAGCCTACCAAGTGGCTGGG + Intergenic
1104366595 12:128183612-128183634 CTTCAGACTACCCAGGCACTGGG - Intergenic
1104625274 12:130348173-130348195 CTTCATACAAACCTGTGACTTGG - Exonic
1105757092 13:23476384-23476406 CTTCAGACTGCCAAGTAGCTGGG - Intergenic
1106070387 13:26405961-26405983 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1106154592 13:27142004-27142026 CTTCAGCCTTGCAAGTGGCTGGG - Intronic
1106438298 13:29742938-29742960 CTTCAGACTCCCAAGTAGCTGGG - Intergenic
1106745706 13:32704282-32704304 CCTCAGCCTTACAAGTAACTGGG + Intronic
1106798524 13:33232195-33232217 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1106887634 13:34207010-34207032 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1107785706 13:43955313-43955335 TTTCAGAGTAACAAATGAATAGG + Intergenic
1107841800 13:44465855-44465877 CTTCAGGCTCCCAAGTGGCTGGG - Intronic
1107907443 13:45074332-45074354 CCTCAGCCTACCAAGTAACTGGG + Intergenic
1108791626 13:53975426-53975448 TTTCAGACAAACAAATGACGAGG + Intergenic
1109954254 13:69544966-69544988 CTTCAGCCTCCCAAGTGTCTAGG - Intergenic
1110284626 13:73735179-73735201 CTTCAGCCTCCCAAGTTACTGGG - Intronic
1110318911 13:74137874-74137896 CCTCAGACTCACAAGTAGCTAGG + Intergenic
1110432504 13:75441138-75441160 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1110608769 13:77465269-77465291 TTTCAGCCTTGCAAGTGACTGGG + Intergenic
1110701620 13:78555214-78555236 CCTCAGCCTCACAAGTAACTGGG - Intergenic
1111338240 13:86849361-86849383 TTTCAGACAAACAAGTGCTTAGG + Intergenic
1111465776 13:88607530-88607552 CCTCAGACTCCCAAGTAACTGGG + Intergenic
1111938711 13:94585682-94585704 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1112011469 13:95297153-95297175 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1112164772 13:96906662-96906684 CCTCAGCCTCACAAGTAACTGGG + Intergenic
1112800598 13:103105548-103105570 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
1113359809 13:109620078-109620100 CCTCAGACTTCCAAGTGGCTGGG + Intergenic
1113359853 13:109620385-109620407 CCTCAGACTACCGAGTGGCTGGG + Intergenic
1113420531 13:110168133-110168155 CTTCAGCCTTCCAAGTGGCTGGG + Intronic
1114404860 14:22447070-22447092 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1114428872 14:22643409-22643431 CCTCAGACTCCCAAGTAACTGGG + Intergenic
1114450833 14:22824211-22824233 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1114637647 14:24196969-24196991 CCTCAGCCTCACAAGTGGCTGGG - Intronic
1114970501 14:28021131-28021153 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1115255930 14:31401639-31401661 CTTCAGCCTACCATGTAACTTGG + Intronic
1115263023 14:31472870-31472892 CTTCAGACCCACAAGTAGCTGGG + Intergenic
1115574276 14:34695506-34695528 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1115606435 14:35007075-35007097 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1115629190 14:35226848-35226870 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1116151627 14:41148812-41148834 CTTCAGCCTCCCAAGTAACTCGG - Intergenic
1117011308 14:51473321-51473343 CAACAGACCAACAAGTGGCTGGG - Intergenic
1117230276 14:53709903-53709925 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1117840316 14:59853978-59854000 CTTCAGCCTCACAAGTAGCTGGG + Intronic
1117921425 14:60728771-60728793 CTTCAGCCTCACAAGTAGCTAGG - Intergenic
1118011273 14:61612980-61613002 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1118032850 14:61835372-61835394 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1120273953 14:82348582-82348604 CTTCAGACGATCAAATTACTCGG + Intergenic
1120578257 14:86211357-86211379 CTTCACACTAAAAAATTACTAGG + Intergenic
1120631439 14:86896399-86896421 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1120632968 14:86913810-86913832 CCTCAGCCTCACAAGTAACTGGG + Intronic
1121354278 14:93200495-93200517 CCTCAGCCTCACAAGTAACTGGG - Intronic
1121577866 14:95003017-95003039 CTTCAGACGAAGTAGTGACAGGG - Intergenic
1121585384 14:95059730-95059752 CTTCAGCCTACCGAGTAACTGGG - Intergenic
1121760340 14:96439546-96439568 CTTCAGCCTAACGAGTAGCTGGG - Intronic
1121771710 14:96549900-96549922 CTGCAGCCTCACAAGTCACTGGG - Intronic
1121907608 14:97761377-97761399 CCTCAGCCTACCAAGTGGCTGGG - Intronic
1122126387 14:99580747-99580769 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1122166088 14:99825097-99825119 CCTCAGCCTGACAAGTAACTGGG + Intronic
1122395093 14:101420733-101420755 CTTCAGCCTCCCAAGTAACTAGG - Intergenic
1123462344 15:20484707-20484729 CTTCAGCCTCCCGAGTGACTGGG - Intergenic
1123655715 15:22515687-22515709 CTTCAGCCTCCCGAGTGACTGGG + Intergenic
1123726346 15:23106071-23106093 CTTCAGCCTCTCAAGTAACTGGG - Intergenic
1123908056 15:24939903-24939925 CTTCAGCCTCACAAGTAACTGGG + Intronic
1123951672 15:25284512-25284534 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1124194768 15:27613818-27613840 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1124273034 15:28300705-28300727 CTTCAGCCTCCCGAGTGACTGGG - Intronic
1124309624 15:28610864-28610886 CTTCAGCCTCCCGAGTGACTGGG + Intergenic
1125236407 15:37519108-37519130 CTTCAGCCTCTCAAGTGGCTAGG - Intergenic
1125918482 15:43510351-43510373 CTTCAGAATAACAACTCACCAGG + Intronic
1126156243 15:45568140-45568162 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1126715687 15:51514911-51514933 CATCAGATTCACAACTGACTAGG + Intronic
1126718906 15:51555040-51555062 CCTCAGCCTCCCAAGTGACTGGG - Intronic
1126986132 15:54311231-54311253 CTTAAAAATAACTAGTGACTTGG - Intronic
1127921049 15:63494352-63494374 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1128164634 15:65452854-65452876 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1129017369 15:72480375-72480397 CTTCAGCCTCTCAAGTAACTGGG + Intronic
1129415167 15:75372703-75372725 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1129513426 15:76141349-76141371 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1129685845 15:77685733-77685755 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1129748927 15:78046580-78046602 CTTCAGCCTACCAAGTAGCTGGG + Intronic
1129851180 15:78794831-78794853 CCTCAGACTCCCAAGTGGCTAGG + Intronic
1130139510 15:81212585-81212607 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1130175187 15:81561545-81561567 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1130313429 15:82774186-82774208 CTTCAGTCTCCCAAGTAACTGGG + Intronic
1130444335 15:83985746-83985768 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1130704512 15:86220065-86220087 CCTCAGCCTCACAAGTAACTGGG + Intronic
1130708752 15:86258820-86258842 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1131017410 15:89069376-89069398 CTTCAGCCTTCCAAGTAACTGGG + Intergenic
1131138319 15:89956242-89956264 CATCAGGCTAACAAGTCATTAGG + Intergenic
1132050232 15:98601619-98601641 CTTCAGCCTCTCAAGTAACTGGG + Intergenic
1132107335 15:99072590-99072612 CCTCAGCCTCACAAGTGGCTGGG + Intergenic
1132770897 16:1562654-1562676 CCTCAGACTACCAAGTAGCTGGG - Intronic
1132878894 16:2152553-2152575 GTTCAGCCTCCCAAGTGACTGGG - Intronic
1132898282 16:2239025-2239047 CTTGAGACAGACAAGTGCCTGGG - Intergenic
1133112781 16:3558885-3558907 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1133798386 16:9065053-9065075 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
1134408763 16:13985647-13985669 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1134409028 16:13987951-13987973 CTTCAGCCTCCCAAGTAACTAGG + Intergenic
1134414752 16:14033719-14033741 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1134556491 16:15170149-15170171 CTTCAGCCTCCCAAGTTACTGGG - Intergenic
1134917071 16:18081862-18081884 CTTCAGCCTCCCAAGTTACTGGG - Intergenic
1135095411 16:19560678-19560700 CCTCAGCCTCCCAAGTGACTGGG - Intronic
1135107380 16:19662085-19662107 CTTCAGCCTGCCAAGTGGCTGGG - Intronic
1135163792 16:20121077-20121099 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1135591426 16:23707597-23707619 CCTCAGACTCACAAGTAGCTGGG - Intronic
1135697930 16:24606630-24606652 CCTCAGCCTCACAAGTAACTGGG + Intergenic
1136613920 16:31383924-31383946 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
1136623769 16:31448591-31448613 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1136726419 16:32360957-32360979 CATCAGACTCCCAAGTGGCTGGG - Intergenic
1136844661 16:33566469-33566491 CATCAGACTCCCAAGTGGCTGGG - Intergenic
1137346888 16:47670603-47670625 CCTCAGACTCCCAAGTGGCTGGG + Intronic
1137498575 16:48992850-48992872 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1138009739 16:53367032-53367054 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
1138686593 16:58731773-58731795 CTTCAGAATAACAACAGACAAGG + Intronic
1139426421 16:66882939-66882961 CCTCAGCCTTACAAGTGAATGGG + Intronic
1139498193 16:67336881-67336903 CTTCAGCCTACCAAGTAGCTAGG + Intronic
1139512885 16:67437335-67437357 CTGCAAACTAAGGAGTGACTAGG + Exonic
1139755319 16:69138351-69138373 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1139877060 16:70154753-70154775 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1140324708 16:73990696-73990718 CTTCAGCCTCTCAAGTGGCTGGG + Intergenic
1140359965 16:74335847-74335869 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
1140487119 16:75302374-75302396 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1140717779 16:77742482-77742504 CCTCAGACTCCCAAGTAACTGGG + Intergenic
1140860207 16:79011606-79011628 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1140867976 16:79080714-79080736 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1141428404 16:83957990-83958012 CTTCAGCCTACCAAGTAGCTGGG + Intronic
1141457408 16:84152532-84152554 CCTCAGCCTCACAAGTAACTAGG - Intronic
1141558706 16:84852949-84852971 CCTCAGCCTCACAAGTAACTGGG - Intronic
1141929639 16:87193507-87193529 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1203000014 16_KI270728v1_random:156800-156822 CATCAGACTCCCAAGTGGCTGGG + Intergenic
1203131614 16_KI270728v1_random:1693201-1693223 CATCAGACTCCCAAGTGGCTGGG + Intergenic
1203154829 16_KI270728v1_random:1866767-1866789 CATCAGACTCCCAAGTGGCTGGG - Intergenic
1143460121 17:7097525-7097547 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1143636355 17:8165909-8165931 CCTCAGACTCCCAAGTGGCTGGG + Intergenic
1144201430 17:12945900-12945922 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1144290104 17:13818094-13818116 CTTCAGACTGCCAAATGCCTAGG - Intergenic
1144373473 17:14615930-14615952 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1144941532 17:18945472-18945494 CCTCAGACTCCCAAGTGGCTGGG - Intergenic
1145281859 17:21473836-21473858 CCTCAGACTCCCAAGTCACTGGG + Intergenic
1145360866 17:22211291-22211313 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1146171253 17:30635349-30635371 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1146281465 17:31547855-31547877 CCTCAGCCTACCAAGTAACTAGG + Intergenic
1146344716 17:32051363-32051385 CTTCAGCCTCACAAGTAGCTGGG - Intronic
1146395826 17:32465857-32465879 CCTCAGCCTAACAAGTAGCTGGG - Intronic
1146578513 17:34014998-34015020 CTTCAGACTTCCAAGTAGCTGGG + Intronic
1146903605 17:36603515-36603537 CTTCAGCCTTCCAAGTAACTGGG + Intronic
1147517536 17:41135264-41135286 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1147956920 17:44141149-44141171 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
1148098434 17:45071308-45071330 CTTCAGCCTCCCGAGTGACTGGG + Intronic
1148538976 17:48464776-48464798 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1148674528 17:49437709-49437731 CCTCAGACTCCCAAGTAACTGGG + Intronic
1148888158 17:50788491-50788513 CTTCAGCCTCACAAGTAACTGGG + Intergenic
1149190679 17:54057859-54057881 CGTAAAACTAACAAGTGACTGGG - Intergenic
1149662282 17:58340526-58340548 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1149786745 17:59441997-59442019 CTTCTGAATAACAAATGACAAGG + Intergenic
1150171577 17:63001658-63001680 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
1150443401 17:65209960-65209982 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1150683070 17:67298679-67298701 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
1150739828 17:67770315-67770337 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1150792617 17:68210830-68210852 CCTCAGTCTCACAAGTAACTAGG - Intergenic
1151532975 17:74719332-74719354 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1152712780 17:81882303-81882325 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1152818261 17:82421708-82421730 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1153256715 18:3178981-3179003 CCTCAGACTACCAAGTAGCTGGG + Intronic
1153308268 18:3652441-3652463 CTTCAGACTCCCAAGTAGCTAGG + Intronic
1153877612 18:9388803-9388825 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1153921873 18:9798966-9798988 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1154264495 18:12868368-12868390 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1154392223 18:13948014-13948036 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
1155078460 18:22383945-22383967 CTTAAAACTAACAAGGGACCAGG + Intergenic
1155305655 18:24475507-24475529 CTTCAGCCTCCCAAGTGGCTAGG - Intronic
1155383402 18:25249575-25249597 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1155502878 18:26504621-26504643 CTTCAGCCTCCCAAGTCACTGGG + Intronic
1155503883 18:26514300-26514322 CTTCAGCCTCCCAAGTCACTGGG - Intronic
1155921073 18:31603480-31603502 CTTCTGACAATCAACTGACTTGG + Intergenic
1156405809 18:36781534-36781556 CTTCAGCCTCCCGAGTGACTGGG - Intronic
1157049432 18:44144629-44144651 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1157134679 18:45042263-45042285 CCTCAGCCTACCAAGTGGCTGGG + Intronic
1157860964 18:51139709-51139731 CTTCAGCCTCCCAAGTGTCTGGG + Intergenic
1158280400 18:55819284-55819306 CTTCACAACAACAAGTCACTTGG - Intergenic
1158415132 18:57243639-57243661 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1158659676 18:59374828-59374850 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1158661332 18:59391030-59391052 CTTCAGCCTCTCTAGTGACTGGG + Intergenic
1158878422 18:61753793-61753815 CCTCAGCCTCACAAGTCACTGGG + Intergenic
1159347276 18:67222553-67222575 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1159597621 18:70397890-70397912 CCTCAGACTCCCAAGTGGCTAGG - Intergenic
1159682592 18:71373121-71373143 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1160102096 18:75931951-75931973 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1160116358 18:76082705-76082727 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1160761368 19:786808-786830 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1160817828 19:1044361-1044383 CTTCAGCCTCACAAGTAACTGGG + Intronic
1161290182 19:3489914-3489936 CCTCAGCTTAACAAGTAACTGGG - Intergenic
1161490987 19:4561343-4561365 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1161653705 19:5500174-5500196 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1161670345 19:5604287-5604309 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1162003060 19:7760339-7760361 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1162071880 19:8157770-8157792 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1162114532 19:8420764-8420786 CCTCAGCCTCACAAGTGGCTGGG + Intronic
1162179155 19:8855460-8855482 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1162648652 19:12068192-12068214 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1162902651 19:13804529-13804551 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1162969802 19:14173829-14173851 CTTCAGCCTCGCAAGTGGCTGGG - Intronic
1163017615 19:14466300-14466322 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1163854397 19:19689891-19689913 CCTCAGACTTCCAAGTAACTGGG + Intergenic
1163955993 19:20641018-20641040 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1164062000 19:21683679-21683701 CTTCAGCCTCTCAAGTAACTGGG + Intergenic
1164505070 19:28853395-28853417 CTTCAGACTCCCAAGTAGCTGGG - Intergenic
1165131270 19:33633912-33633934 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1165651600 19:37495720-37495742 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1165692107 19:37871618-37871640 CCTCAGCCTACCAAGTAACTGGG - Intergenic
1165736586 19:38180657-38180679 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1165787598 19:38471412-38471434 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1165919281 19:39283571-39283593 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1166165516 19:40985031-40985053 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1166336282 19:42109753-42109775 CTTCAGACTCCCAAGTAGCTGGG + Intronic
1166579881 19:43886532-43886554 CCTCAGACTCCCAAGTAACTGGG - Intronic
1166693807 19:44840831-44840853 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1166800369 19:45453009-45453031 CTTCAGCCTTCCAAGTGGCTGGG - Intronic
1166841507 19:45699983-45700005 CTTCAGCCTCCCAAGTCACTGGG - Intronic
1167167184 19:47806402-47806424 CCTCAGCCTAACAAGTAGCTGGG - Intronic
1167253197 19:48412211-48412233 CCTCAGCCTCACAAGTAACTGGG - Intronic
1167511279 19:49896547-49896569 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1167530830 19:50015167-50015189 GTTCAGACTAAGATGTGACCAGG + Intronic
1167682056 19:50929757-50929779 CCTCAGCCTCACAAGTAACTGGG + Intergenic
1167923461 19:52803841-52803863 CCTCAGACTACCAAGTACCTGGG - Intronic
1167963262 19:53124122-53124144 CCTCAGCCTACCAAGTGGCTGGG - Intronic
1168165652 19:54545622-54545644 CCTCAGACTCCCAAGTGGCTGGG - Intronic
1168380219 19:55913944-55913966 CTTCAGAGCAACAAGGGATTTGG + Intronic
1168409700 19:56131894-56131916 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1202685132 1_KI270712v1_random:42527-42549 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
925992669 2:9266260-9266282 CTTCAGCCTCACCAGTAACTGGG + Intronic
926395017 2:12432045-12432067 CCTCAGACTCCCAAGTGGCTGGG + Intergenic
926459438 2:13110545-13110567 CTTATGACTAAAAAGTGATTGGG + Intergenic
927248162 2:20974610-20974632 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
927351153 2:22117548-22117570 CTTCAGCCTCACAAGTAGCTAGG + Intergenic
927362772 2:22255757-22255779 CTTCAGCCTACCAAGTAGCTGGG + Intergenic
927629494 2:24760253-24760275 CTTCAGACTCCCAAGTAGCTGGG + Intronic
927736720 2:25530319-25530341 CTTCAGCCTCACAAGTAGCTGGG - Intronic
928178099 2:29048792-29048814 CTTCAGGCTCCCAAGTAACTGGG + Intronic
928525155 2:32132273-32132295 CTTCAGTCTCCCAAGTGGCTGGG - Intronic
928550595 2:32366864-32366886 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
928567570 2:32568726-32568748 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
928665123 2:33543126-33543148 CCTCAGCCTCACAAGTGGCTGGG + Intronic
928692670 2:33816909-33816931 CTTCAGCCTTCCAAGTAACTGGG + Intergenic
928952440 2:36824928-36824950 CCTCAGCCTAGCAAGTGGCTGGG + Intergenic
928960625 2:36922401-36922423 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
929124148 2:38507981-38508003 CTTCAGATTCCCAAGTAACTGGG - Intergenic
929497174 2:42455651-42455673 CTTCAGCCTCCCAAGTAACTGGG - Intronic
929625779 2:43405128-43405150 CTTCACATAAACAAGTGAATAGG - Intronic
929736370 2:44554618-44554640 CCTCAGACTCCCAAGTAACTGGG - Intronic
929888470 2:45899495-45899517 CCTCAGCCTCCCAAGTGACTGGG + Intronic
929972228 2:46592099-46592121 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
930369841 2:50488656-50488678 ATTCAGACTGACAAGTGATGTGG - Intronic
930632977 2:53773917-53773939 CCTCAGCCTCTCAAGTGACTGGG - Intronic
930984439 2:57567997-57568019 CCTCAGCCTCACAAGTAACTGGG + Intergenic
931551944 2:63456299-63456321 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
931725198 2:65103203-65103225 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
932253940 2:70267671-70267693 CTTCAGCCTGCCAAGTGCCTGGG - Intronic
932542394 2:72668969-72668991 TTTCAGACTCCCAAGTGGCTAGG - Intronic
933406752 2:81870103-81870125 CTTCAGGCTCCCAAGTAACTGGG - Intergenic
933518857 2:83344964-83344986 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
934246590 2:90312329-90312351 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
934279150 2:91596306-91596328 CTTCAGCCTACCAAGTAGCTGGG + Intergenic
934668116 2:96188158-96188180 CCTCAGACTCCCAAGTAACTGGG - Intronic
935225877 2:101052590-101052612 CTTCAGCCTCCCAAGTAACTGGG + Intronic
935538611 2:104323493-104323515 CTTCAGTCTAACAAAGCACTAGG - Intergenic
936405699 2:112200648-112200670 CCTCAGCCTCACAAGTGGCTGGG + Intergenic
936453692 2:112653906-112653928 CTTCAGCCTCCCAAGTAACTGGG + Intronic
936517343 2:113190548-113190570 CTTCAGCCTCCCAAGTAACTGGG + Intronic
936654118 2:114464747-114464769 CCTCAGACTCACAAGTAGCTGGG - Intronic
937822810 2:126330153-126330175 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
938014030 2:127852356-127852378 CTTCAGCCTCCCAAGTAACTAGG + Intronic
938850977 2:135259133-135259155 CCTCAGACTCCCAAGTGGCTGGG + Intronic
939246237 2:139626651-139626673 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
939277958 2:140026281-140026303 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
939518976 2:143205169-143205191 CCTCAGCCTAACAAGTAGCTGGG - Intronic
940156863 2:150665977-150665999 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
940225149 2:151393393-151393415 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
940663554 2:156577373-156577395 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
940951116 2:159675853-159675875 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
941093657 2:161210579-161210601 CTTCAGCCTCTCAAGTGGCTGGG - Intronic
941116974 2:161482775-161482797 CTTCAGCCTGCCAAGTAACTGGG - Intronic
941278315 2:163518325-163518347 CTTCAGTCTTTCAAGTGGCTAGG - Intergenic
941636226 2:167937560-167937582 CCTCAGCCTAACAAGTATCTGGG - Intergenic
941821707 2:169850292-169850314 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
942422916 2:175826430-175826452 AGCCAGACTAACATGTGACTGGG + Intergenic
943131832 2:183863356-183863378 CCTCAGACTGCCAAGTAACTGGG + Intergenic
943180896 2:184540116-184540138 CTTCAAACTTCCAAGTGGCTGGG - Intergenic
943305424 2:186255605-186255627 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
943695452 2:190924797-190924819 CCTCAGCCTCACAAGTAACTGGG - Intronic
944224308 2:197334806-197334828 CCTCAGCCTACCAAGTGGCTGGG - Intergenic
944533891 2:200691123-200691145 CCTCAGCCTCACAAGTAACTGGG - Intergenic
944570708 2:201042070-201042092 CCTCAGACTGCCAAGTGCCTGGG + Intronic
944862471 2:203828150-203828172 CTTCAGTCTCCCAAGTGACTAGG + Intergenic
944982229 2:205134406-205134428 CCTCAGCCTACCAAGTGGCTGGG - Intronic
944987300 2:205191967-205191989 CCTCAGACTCCCAAGTAACTGGG + Intronic
945084592 2:206118508-206118530 CTTCAGTCTCCCAAGTGGCTGGG - Intronic
945386864 2:209211935-209211957 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
945565878 2:211398713-211398735 CTTCAGCCTCCCAAGTAACTGGG - Intronic
945689958 2:213021095-213021117 CTTCAGCCTGCCAAGTAACTGGG - Intronic
945804143 2:214469477-214469499 CTTCAGCCTCCCAAGTAACTGGG - Intronic
946271953 2:218601592-218601614 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
946745860 2:222845258-222845280 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
947360221 2:229339118-229339140 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
947509597 2:230739608-230739630 CTTCAGCCTCCCAAGTGGCTAGG + Intronic
947564381 2:231184856-231184878 CTTCAGCCTCTCAAGTAACTGGG - Intergenic
947665049 2:231900195-231900217 CTTCAGTCTCCCAAGTGGCTGGG - Intergenic
947760703 2:232601821-232601843 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
947995119 2:234521085-234521107 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
948043630 2:234925823-234925845 CCTCAGGCTCACAAGTAACTGGG + Intergenic
1168758962 20:335588-335610 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
1168834281 20:867532-867554 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1169101474 20:2953721-2953743 CCTCAGACTTCCAAGTGGCTGGG + Intronic
1169114487 20:3054606-3054628 CTTCAGCCTCCCAAGTGTCTGGG - Intergenic
1169165916 20:3423885-3423907 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1169713401 20:8589729-8589751 CCTCAGCCTTCCAAGTGACTGGG + Intronic
1171465501 20:25325088-25325110 CCTCAGCCTCACAAGTGGCTGGG - Intronic
1172059910 20:32180315-32180337 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1172174661 20:32965032-32965054 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1172348302 20:34221992-34222014 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1172360340 20:34308432-34308454 CCTCAGCCTCACAAGTAACTGGG - Intronic
1172415650 20:34765004-34765026 CCTCAGCCTCACGAGTGACTAGG - Intronic
1172497202 20:35396098-35396120 CCTCAGACTCCCAAGTGGCTGGG + Intronic
1172535695 20:35671453-35671475 CTTCAGACTCCCAAGTAGCTAGG - Intronic
1173065157 20:39703613-39703635 CTTCAGCCTCCCAAGTAACTAGG - Intergenic
1173379503 20:42527077-42527099 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1173671959 20:44805188-44805210 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1173996910 20:47345621-47345643 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1174007755 20:47424085-47424107 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1174176274 20:48647112-48647134 CCTCAGCCTCCCAAGTGACTAGG - Intronic
1174347317 20:49939936-49939958 CTTCAGACTCCCAAGTGGCTGGG - Intronic
1174384257 20:50177519-50177541 CCTCAGCCTCACAAGTAACTGGG + Intergenic
1174539938 20:51281346-51281368 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1174688211 20:52476108-52476130 CTTCAGCCCAACGAGGGACTGGG + Intergenic
1174707109 20:52668089-52668111 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1174907491 20:54566730-54566752 CTTCAGCCTACCAAGTAGCTAGG + Intronic
1175065257 20:56279026-56279048 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1176211519 20:63925365-63925387 CTTCAGCCTCCCAAGTCACTGGG - Intronic
1176480437 21:7281410-7281432 CTTCAGACAATCAAATTACTCGG + Intergenic
1176519672 21:7815206-7815228 CTTCAGGCTCCCAAGTGGCTGGG + Intergenic
1177511626 21:22094087-22094109 CCTCAGACTCCCAAGTGGCTGGG - Intergenic
1177511713 21:22095328-22095350 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1178423726 21:32462276-32462298 CTTCAGCCTCCCAAGTGGCTAGG - Intronic
1178444335 21:32624906-32624928 CTTCAGATTCAGAAGTCACTTGG - Intergenic
1178653700 21:34445219-34445241 CTTCAGGCTCCCAAGTGGCTGGG + Intergenic
1178766214 21:35453357-35453379 CCTCAGACTCCCAAGTAACTGGG - Intronic
1180917225 22:19497628-19497650 CTTCACACAAACATGGGACTTGG + Intronic
1180925160 22:19548645-19548667 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1181299842 22:21871912-21871934 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1181392998 22:22597318-22597340 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1181455363 22:23057188-23057210 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1181553749 22:23655684-23655706 CTTCAGACTTTCAAGTAGCTGGG - Intergenic
1181628357 22:24136463-24136485 CTTCAGCCTCACAAGTAGCTGGG + Intronic
1182129022 22:27837113-27837135 CTTCAGCCTCCCAAGTGCCTGGG - Intergenic
1183111315 22:35650812-35650834 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1183775590 22:39962566-39962588 CCTCAGTCTAACAAATTACTTGG - Intronic
1183895851 22:40968204-40968226 CCTCAGCCTAGCAAGTGGCTGGG + Intronic
1183921795 22:41175762-41175784 CTTCAGAGTAACAATGGTCTGGG - Intronic
1184182262 22:42837794-42837816 CCTCAGACTCCCAAGTGGCTAGG + Intronic
1185106850 22:48875884-48875906 CTTCAGCCTCACAAGTACCTGGG - Intergenic
1185323372 22:50213174-50213196 CTTCAGACTCCCAAGTAGCTGGG + Intronic
949299149 3:2562837-2562859 CCTCAGCCTCACAAGTAACTGGG + Intronic
949541878 3:5038911-5038933 CCTCAGCCTCACAAGTGGCTAGG - Intergenic
950285854 3:11744181-11744203 CTTCAGCCTCTCAAGTAACTGGG + Intergenic
950739313 3:15037004-15037026 CCTCAGCCTAGCAAGTAACTGGG - Intronic
950771239 3:15313143-15313165 CTTCAGCCTCACAAGTAGCTGGG - Intronic
950859217 3:16132722-16132744 CTTTAGTCTAACAAGTAGCTGGG - Intergenic
951530628 3:23694972-23694994 CTTCAGCCTCTCAAGTGGCTAGG - Intergenic
951556769 3:23928879-23928901 CTTCAGCCTACCAAGTGGCTGGG - Intronic
952034719 3:29186447-29186469 CTTCAATCAAACTAGTGACTTGG - Intergenic
952799764 3:37278926-37278948 CCTCAGCCTTCCAAGTGACTGGG + Intronic
953281061 3:41557648-41557670 CTTCAGCCTCCCAAGTAACTAGG - Intronic
953396794 3:42579484-42579506 CTTCAGACTCCCAAGTAGCTGGG - Intronic
953606164 3:44414736-44414758 CTTCTGACTGAGAAGGGACTGGG - Intergenic
953746416 3:45577465-45577487 CCTCAGCCTCCCAAGTGACTGGG - Intronic
953752709 3:45621343-45621365 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
953761043 3:45687513-45687535 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
953829606 3:46284428-46284450 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
953951902 3:47197739-47197761 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
953953277 3:47209521-47209543 CCTCAGCCTCACAAGTGGCTGGG + Intergenic
954065732 3:48104478-48104500 CTTCAGTCTCACAAGTAGCTGGG + Intergenic
954276494 3:49545272-49545294 CCTCAGACTCCCAAGTAACTGGG + Intergenic
954535026 3:51353494-51353516 CTTCAGCCTCTCAAGTAACTGGG - Intronic
954559508 3:51544720-51544742 CCTCAGCCTCACAAGTAACTGGG + Intronic
954643980 3:52119508-52119530 CCTCAGCCTCCCAAGTGACTAGG + Intronic
954667935 3:52268928-52268950 CCTCAGCCTTACAAGTGGCTGGG + Intronic
954733227 3:52683256-52683278 CTTCAGCCTCCCAAGTAACTGGG - Intronic
954953497 3:54495631-54495653 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
955012860 3:55036581-55036603 CTTCAGCCTCCCAAGTAACTGGG + Intronic
955048697 3:55387820-55387842 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
956421148 3:69087134-69087156 CCTCAGTCTCCCAAGTGACTGGG + Intronic
956422337 3:69098190-69098212 CCTCAGCCTACCAAGTAACTGGG + Intronic
956618732 3:71199218-71199240 CTTCAGACTCCCAAGTAGCTGGG + Intronic
957635157 3:82774225-82774247 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
957825588 3:85438786-85438808 CTTCAGCCTCCCAAGTGTCTGGG + Intronic
957856536 3:85885734-85885756 CTTCAGACTCCCAAGTAGCTGGG - Intronic
958426757 3:93987762-93987784 CTTCAGCCTCCCAAGTAACTGGG + Intronic
958704923 3:97642470-97642492 CTTCAGACGATCAAATTACTCGG + Intronic
958852590 3:99347022-99347044 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
959059554 3:101603814-101603836 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
959419912 3:106116706-106116728 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
959742260 3:109734622-109734644 CTTCAGAAAATGAAGTGACTTGG + Intergenic
959914952 3:111806599-111806621 CTTCAGCCTCTCAAGTAACTGGG + Intronic
959982434 3:112530284-112530306 CCTCAGCCTCACAAGTAACTGGG - Intergenic
960379448 3:116941180-116941202 TTTCAGACAAACAAGTGATGAGG + Intronic
960703223 3:120457578-120457600 CCTCAGCCTACCAAGTAACTGGG + Intergenic
960827585 3:121807335-121807357 CTACAGATCAACAGGTGACTTGG - Exonic
960894104 3:122483458-122483480 CTTCAGCCTCACAAGTAGCTGGG + Intronic
961557006 3:127702643-127702665 CTTCATACTAAAAAGTAATTTGG - Intronic
961814249 3:129540565-129540587 CTTCAGTCTTCCAAGTGGCTAGG - Intergenic
963159400 3:142135219-142135241 CTTCAGCCTCACAAGTAGCTGGG + Intronic
963642129 3:147873852-147873874 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
964121957 3:153194403-153194425 CCTCAGCCTCACGAGTGACTAGG + Intergenic
964207496 3:154190391-154190413 CCTCAGCCTCACAAGTAACTGGG - Intronic
964782086 3:160350697-160350719 CTCCAGCCTCACAAGTAACTGGG - Intronic
965060799 3:163783499-163783521 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
965180051 3:165390773-165390795 CCTCAGCCTAACAAGTAGCTGGG + Intergenic
966162432 3:176982802-176982824 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
966764220 3:183445671-183445693 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
966872033 3:184297016-184297038 CTTCAGCCTCCCAAGTAACTGGG - Intronic
967165617 3:186776964-186776986 CCTCAGACTCCCAAGTAACTGGG + Intergenic
967661765 3:192119985-192120007 CCTCAGCCTCACAAGTAACTAGG - Intergenic
967917758 3:194591376-194591398 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
968124702 3:196150123-196150145 CTACAGCATAACTAGTGACTTGG + Intergenic
968158041 3:196399550-196399572 CCTCAGACTCCCAAGTAACTAGG + Intronic
968165908 3:196465083-196465105 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
968533453 4:1109121-1109143 CCTCAGGCTCCCAAGTGACTGGG + Intronic
969652611 4:8476857-8476879 CCTCAGCCTGTCAAGTGACTGGG + Intronic
969926077 4:10587078-10587100 CCTCAGCCTCACAAGTAACTGGG + Intronic
969951266 4:10838235-10838257 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
970759638 4:19469254-19469276 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
970848649 4:20574669-20574691 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
971206031 4:24569884-24569906 CTTCAGCCTACGAAGTGGCTGGG + Intronic
971303246 4:25458962-25458984 CTTCAGTCTTACAAGTAGCTGGG + Intergenic
971340239 4:25762062-25762084 CTTCAGCCTCCCAAGTAACTGGG + Intronic
971573643 4:28246214-28246236 TTTCAGGCTAACAAGAGAATTGG - Intergenic
971751949 4:30661845-30661867 CCTCAGACTCACAAGTAGCTGGG - Intergenic
971908707 4:32764817-32764839 CTTCAGATTAAGAAATGAGTAGG + Intergenic
972147206 4:36042956-36042978 CCTCAGCCTACCAAGTAACTGGG + Intronic
972444108 4:39127203-39127225 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
972540415 4:40034479-40034501 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
972653187 4:41039742-41039764 CTTCAGCCTCTCAAGTAACTAGG - Intronic
973898887 4:55446207-55446229 CTTCAGCCTCTCAAGTGGCTGGG + Intronic
974043460 4:56877777-56877799 CTTCAGCCTCTCAAGTGGCTGGG + Intergenic
974139066 4:57860632-57860654 TTTCAGACTTAGAAGGGACTGGG + Intergenic
975564270 4:75737577-75737599 CCTCAGTCTAACAAGTAGCTGGG - Intronic
975590560 4:75995719-75995741 CTTCAGTCTCCCAAGTGGCTGGG + Intergenic
975754390 4:77558466-77558488 CTTCAGCCTCCCAAGTAACTGGG + Intronic
976971997 4:91115440-91115462 CCTCAGACTACCAAGTGGTTGGG + Intronic
977532446 4:98216195-98216217 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
977598655 4:98912134-98912156 CTTCAGCCTCCCAAGTAACTGGG - Intronic
977747502 4:100567707-100567729 CTTCAGCCTCCCAAGTAACTAGG - Intronic
977769386 4:100839472-100839494 CTTCAGCCTCCCAAGTAACTGGG + Intronic
978422494 4:108547432-108547454 CCTCAGCCTAACAAGTAGCTGGG - Intergenic
978574173 4:110171803-110171825 CCTCAGACTCCCAAGTAACTGGG + Intronic
978581800 4:110239175-110239197 CCTCAGACTCCCAAGTAACTGGG - Intergenic
978980986 4:114945091-114945113 CTTCAGCCTACCAAGTAGCTGGG - Intronic
979693710 4:123587954-123587976 CCTCAGACTCCCAAGTAACTGGG + Intergenic
979703727 4:123695888-123695910 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
980315389 4:131192755-131192777 CCTCAGCCTCTCAAGTGACTGGG - Intergenic
980952978 4:139399970-139399992 CCTCAGTCTCCCAAGTGACTGGG - Intronic
981233836 4:142391444-142391466 CCTCAGACTCCCAAGTAACTGGG - Intronic
981489658 4:145326238-145326260 CCTCAGCCTCACAAGTAACTGGG + Intergenic
981703454 4:147633485-147633507 CTTCAGCCTCCCAAGTAACTAGG - Intronic
982041801 4:151404998-151405020 CTTCAGACTCACGAGTGGCTGGG + Intergenic
982104089 4:151996798-151996820 CCTCAGACTCCCAAGTGGCTGGG - Intergenic
982261978 4:153502065-153502087 CCTCAGACTCACAAGTAGCTGGG + Intronic
982998526 4:162381958-162381980 CTTCAGCCTCAAAAGTGGCTGGG - Intergenic
983201416 4:164864188-164864210 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
983201553 4:164865560-164865582 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
983226461 4:165090265-165090287 CCTCAAACTCTCAAGTGACTGGG - Intronic
983984222 4:174038628-174038650 TTTTAAACTAAGAAGTGACTTGG + Intergenic
984482902 4:180328661-180328683 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
984768915 4:183420847-183420869 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
984776967 4:183490253-183490275 CCTCAGACTCCCAAGTAACTGGG - Intergenic
984812745 4:183809195-183809217 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
986728279 5:10616446-10616468 CTTCAGTCTCTCAAGTAACTGGG - Intronic
987148370 5:15014706-15014728 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
987189782 5:15464278-15464300 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
988046364 5:25960912-25960934 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
988164977 5:27575748-27575770 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
988252130 5:28772950-28772972 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
988459306 5:31418382-31418404 CTTCAGCCTCCCAAGTAACTGGG + Intronic
988980709 5:36565186-36565208 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
989039024 5:37208062-37208084 CCTCAGCCTCCCAAGTGACTGGG + Intronic
989071369 5:37514898-37514920 CCTCAGCCTCCCAAGTGACTGGG - Intronic
989454828 5:41631253-41631275 CCTCAGACTCCCAAGTAACTGGG + Intergenic
990470819 5:56113763-56113785 CTTCAGCCTCCCAAGTGTCTGGG + Intronic
990584832 5:57200795-57200817 CCTCAGGCTAACAAGTAGCTGGG + Intronic
990951609 5:61304233-61304255 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
991718435 5:69473564-69473586 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
992117510 5:73554714-73554736 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
992553268 5:77879690-77879712 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
992568820 5:78030790-78030812 CTTCAGTCTCCCAAGTGGCTAGG + Intronic
993060020 5:83028056-83028078 CTTCAGACTCCCAAGTAGCTTGG + Intergenic
993327056 5:86553491-86553513 CTTCAGTCTCCCAAGTAACTGGG - Intergenic
993480939 5:88423648-88423670 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
994793932 5:104269050-104269072 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
994838267 5:104885962-104885984 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
995298034 5:110542431-110542453 CTTCAGATTATCATGTGACAGGG + Intronic
995774791 5:115713262-115713284 CCTCAGCCCCACAAGTGACTGGG + Intergenic
996035432 5:118753478-118753500 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
996334773 5:122371189-122371211 CTTCAGCCTCCCAAGTCACTGGG - Intronic
996336227 5:122387070-122387092 ATTCAGATTCACAAATGACTAGG + Intronic
996424130 5:123294326-123294348 CCTCAGACTCCCAAGTAACTAGG + Intergenic
996720713 5:126627681-126627703 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
997130320 5:131269943-131269965 CCTCAGACTCCCAAGTGGCTGGG - Intronic
997548541 5:134732522-134732544 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
997997668 5:138599471-138599493 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
998209929 5:140187836-140187858 CTTCAAACCAAAAAGTCACTTGG - Intronic
998455699 5:142271141-142271163 CCTCAGCCTCACAAGTAACTGGG - Intergenic
998482317 5:142473184-142473206 CTCCAGAGTTACAAGTCACTGGG - Intergenic
999551934 5:152698862-152698884 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
999803775 5:155062773-155062795 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
1001108446 5:168875516-168875538 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1001437739 5:171713555-171713577 CTTTACAGTAACAAGTGAGTAGG - Intergenic
1001463152 5:171936373-171936395 CCTCAGCCTACCAAGTCACTGGG - Intronic
1001507246 5:172289496-172289518 CTTCAGTCTACCAAGTAGCTGGG + Intergenic
1001625120 5:173125925-173125947 CCTCAGCCTTCCAAGTGACTGGG - Intronic
1001820272 5:174704858-174704880 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1001856022 5:175011767-175011789 GTCCAGACTATCAAGGGACTCGG + Intergenic
1003131803 6:3401220-3401242 CCTCAGCCTCCCAAGTGACTGGG - Intronic
1003428382 6:6014946-6014968 CTTCAGACTACCAAGTAGCTGGG + Intergenic
1003593236 6:7453175-7453197 CCTCAGACTCTCAAGTGGCTGGG + Intergenic
1003610261 6:7607200-7607222 CTTCAGCCCCACAAGTGGCTAGG - Intronic
1003725073 6:8752042-8752064 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1003744834 6:8988834-8988856 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1004328467 6:14699297-14699319 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1005700561 6:28396718-28396740 CTTCAGCCTACCAAGTACCTGGG + Intronic
1005904102 6:30245622-30245644 CTTCAGACTCCCAAGTACCTGGG + Intergenic
1006088269 6:31612518-31612540 CTTCAGCCTCCCAAGTGGCTAGG + Intergenic
1006130132 6:31864188-31864210 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1006190953 6:32208616-32208638 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1006480146 6:34286195-34286217 CTTCAGCCTACCAAGTAGCTGGG + Exonic
1006483711 6:34320340-34320362 CTTCAGGCTCCCAAGTAACTGGG + Intronic
1006493264 6:34402338-34402360 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1006524252 6:34590283-34590305 CATCAGTCTAACAAGTCATTAGG - Exonic
1007002753 6:38329835-38329857 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1007527785 6:42511896-42511918 CTTCAGCCTCCCAAGTGGCTAGG - Intergenic
1007550278 6:42723889-42723911 CCTCAGCCTCACAAGTAACTGGG - Intergenic
1007551705 6:42734984-42735006 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1008543939 6:52569272-52569294 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1008609359 6:53171704-53171726 CTTCAGTTTCCCAAGTGACTTGG - Intergenic
1008734279 6:54523538-54523560 CTTCAGCCTTCCAAGTAACTAGG - Intergenic
1008910885 6:56731326-56731348 CTTCAGTCTTCCAAGTAACTGGG + Intronic
1009431274 6:63569370-63569392 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1009555135 6:65153665-65153687 CTGCATACTGACAAGTGACAAGG + Intronic
1009633267 6:66228041-66228063 CTTCAGCCTACCAAGTAGCTGGG + Intergenic
1009701403 6:67186945-67186967 CTTCAGACTCCCAAGTAGCTGGG - Intergenic
1009708850 6:67291211-67291233 CTTCAACCTCACAAGTGACTGGG - Intergenic
1009963439 6:70552582-70552604 CCTCAGCCTACCAAGTAACTGGG + Intronic
1010537370 6:77047576-77047598 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1010687530 6:78869991-78870013 CCTCAGCCTCACAAGTAACTGGG - Intronic
1011902475 6:92316110-92316132 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1012305447 6:97651306-97651328 CTTCAGCCTTCCAAGTGGCTAGG + Intergenic
1012917240 6:105183530-105183552 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1012932833 6:105334601-105334623 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1013241379 6:108249304-108249326 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1013502614 6:110767468-110767490 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1013522292 6:110944213-110944235 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
1014258948 6:119194437-119194459 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1014269419 6:119320087-119320109 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1014428400 6:121336829-121336851 CTTCAGACTCCCAAGTAGCTAGG + Intergenic
1014949410 6:127537627-127537649 CCTCAGACTAACGAGTAGCTGGG + Intronic
1015098130 6:129441865-129441887 CCTCAGACTCCCAAGTGGCTGGG - Intronic
1015696842 6:135990209-135990231 CCTCAGCCTACCAAGTGGCTGGG + Intronic
1015823294 6:137285377-137285399 CTTCAGCCTCCCAAGTCACTGGG - Intergenic
1015866101 6:137728275-137728297 CTTCAGAATTAGAAGTAACTGGG + Intergenic
1015934980 6:138400176-138400198 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1015936789 6:138412567-138412589 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1015989040 6:138916334-138916356 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1016358882 6:143247245-143247267 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1016415965 6:143834130-143834152 CCTCAGCCTACCAAGTGGCTGGG - Intronic
1016999897 6:149989439-149989461 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1017140863 6:151188857-151188879 CCTCAGACTCCCAAGTGTCTGGG + Intergenic
1017154727 6:151312674-151312696 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1017166392 6:151412115-151412137 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1017236729 6:152124188-152124210 CCTCAGCCTCCCAAGTGACTGGG - Intronic
1017465706 6:154691913-154691935 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1017504532 6:155055844-155055866 CTTCAGACTCCCAAGTAGCTAGG - Intronic
1017648263 6:156558388-156558410 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1018021458 6:159765229-159765251 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1018267454 6:162040519-162040541 CCTCAGACTCCCAAGTAACTGGG + Intronic
1018313119 6:162530939-162530961 CCTCAGGCTACCAAGTAACTGGG - Intronic
1019413027 7:914822-914844 CTTCAGACGGCCAAGTGCCTGGG - Intronic
1019669776 7:2271157-2271179 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1020031665 7:4937622-4937644 CTTCAGCCTGCCAAGTAACTGGG + Intronic
1020233269 7:6336228-6336250 CCTCAGCCTCTCAAGTGACTGGG - Intronic
1021015698 7:15528762-15528784 CTTCAGACTCCCAAGTAGCTGGG + Intronic
1021031783 7:15746068-15746090 CTTCAGACTCCCAAGTAGCTGGG - Intergenic
1021349051 7:19567252-19567274 ATTCAAAATCACAAGTGACTTGG + Intergenic
1021622174 7:22559797-22559819 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1021676743 7:23087845-23087867 CTTCAGACTCCCAAGTAGCTAGG + Intergenic
1021996302 7:26181089-26181111 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1022084240 7:27051094-27051116 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1022259999 7:28695109-28695131 CTTCAGTCTCCCAAGTGGCTGGG - Intronic
1022408119 7:30111733-30111755 CCTCAGCCTACCAAGTAACTGGG + Intronic
1022475066 7:30704714-30704736 CTTTAGAGTAAAAAGTGACCAGG + Intronic
1022731703 7:33032569-33032591 CCTCAGACTCTCAAGTAACTGGG + Intronic
1022893916 7:34729886-34729908 CCTCAGACTCCCAAGTAACTGGG + Intronic
1023315886 7:38936017-38936039 CCTCAGACTACCAAGTAGCTGGG + Intergenic
1023559448 7:41458745-41458767 CCTCAGACTCACAAGTAGCTGGG + Intergenic
1023651692 7:42376833-42376855 CTTCAGACTTCCGAGTAACTGGG - Intergenic
1023934354 7:44728825-44728847 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1024723174 7:52161354-52161376 CCTCAGCCTCACAAGTAACTGGG - Intergenic
1024801904 7:53089173-53089195 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
1025164054 7:56695292-56695314 CCTCAGACTACCAAGTAGCTGGG - Intergenic
1025608454 7:63056303-63056325 CCTCAGTCTCCCAAGTGACTGGG + Intergenic
1025757778 7:64361592-64361614 CCTCAGCCTTACAAGTAACTGGG + Intergenic
1025815170 7:64904202-64904224 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1025941480 7:66078748-66078770 CTTCAGACTCCCAAGTGGCTGGG + Intronic
1026182050 7:68050126-68050148 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1026346850 7:69482010-69482032 CCTCAGACTCCCAAGTAACTGGG + Intergenic
1026426416 7:70298774-70298796 CCTGAGATGAACAAGTGACTGGG + Intronic
1026484454 7:70806425-70806447 CCTCAGCCTCACAAGTAACTGGG + Intergenic
1026577599 7:71586021-71586043 CTTCAGCCTACCAAGTAGCTGGG + Intronic
1026628957 7:72021157-72021179 CTTCAGCCTTCCAAGTGGCTGGG - Intronic
1026809787 7:73453861-73453883 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1026835821 7:73638418-73638440 CTTCAGCCTTCCAAGTGGCTGGG + Intergenic
1026860388 7:73783380-73783402 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
1027037485 7:74935582-74935604 CCTCAGACTCCCAAGTAACTGGG + Intergenic
1027236179 7:76299286-76299308 CCTCAGACTCCCAAGTGGCTGGG - Intergenic
1027380961 7:77609102-77609124 CCTCAGCCTGACAAGTAACTGGG - Intronic
1027410532 7:77912846-77912868 CTTCAGACTCTCAAGTAGCTGGG + Intronic
1027413702 7:77950543-77950565 CCTCAGCCTAACAAGTAGCTGGG - Intronic
1028311382 7:89342197-89342219 ATTGAGACTAACAACTTACTGGG - Intergenic
1028593029 7:92518683-92518705 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1029113878 7:98227274-98227296 CCTCAGCCTAACAAGTAGCTGGG - Intronic
1029121546 7:98271399-98271421 TTTCAGTCTAACAAGTAGCTGGG + Intronic
1029193876 7:98790784-98790806 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1029265839 7:99339411-99339433 CTTCAGCCTCACAAGTAGCTGGG - Intronic
1029291961 7:99508922-99508944 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1029377124 7:100185484-100185506 CTTCAGCCTCACAAGTAGCTGGG - Intronic
1029392376 7:100283909-100283931 CCTCAGACTCCCAAGTAACTGGG - Intergenic
1029546897 7:101215326-101215348 CTTCAGCCTTCCAAGTAACTGGG + Intronic
1029556227 7:101271424-101271446 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1029797934 7:102914726-102914748 CTTTGGACTCACCAGTGACTAGG + Intronic
1030009419 7:105151660-105151682 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1030365365 7:108639744-108639766 CTTCAGGCTAACAAGGCACATGG + Intergenic
1031071992 7:117172064-117172086 CTTCAGCCTCCCAAGTGACTAGG + Intronic
1031171598 7:118298736-118298758 CTTGAGATTTACAAGTGATTTGG + Intergenic
1032113584 7:129097946-129097968 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1032593951 7:133220166-133220188 CCTCAGACTCTCAAGTAACTGGG - Intergenic
1032812106 7:135430527-135430549 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1033336606 7:140458769-140458791 CCTCAGCCTAACAAGTAGCTGGG + Intronic
1033679404 7:143579259-143579281 CATCAGACTAACAGCAGACTTGG - Intergenic
1033692432 7:143750184-143750206 CATCAGACTAACAGCAGACTTGG + Intergenic
1034538281 7:151739583-151739605 CCTCAGCCTCACAAGTGGCTGGG + Intronic
1034923572 7:155103129-155103151 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
1035772384 8:2158200-2158222 CTTCAGAAAAACATGTGACAGGG + Intronic
1035868835 8:3114126-3114148 CTTCAGCCTCCCAAGTGGCTAGG - Intronic
1035949737 8:4006941-4006963 CTTCAGACTCACGAGTAGCTGGG + Intronic
1036247748 8:7134098-7134120 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1036393665 8:8348030-8348052 CTTCAGCCTCCCATGTGACTGGG + Intronic
1036486145 8:9180779-9180801 CTTCAGCCTACCAAGTAGCTGGG + Intergenic
1036552041 8:9824452-9824474 CTTCAGCCTTCCAAGTAACTGGG - Intergenic
1036576728 8:10034376-10034398 CTTCAGCCTCCCAAGTCACTGGG - Intergenic
1036638474 8:10567299-10567321 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1036780979 8:11647213-11647235 CCTCAGACTCCCAAGTGCCTGGG - Intergenic
1036799797 8:11781946-11781968 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1036978233 8:13439206-13439228 CTTCAGCCTACCAAGTACCTAGG - Intronic
1037770988 8:21799702-21799724 CTTCAGACTAACAAGTGACTTGG - Intronic
1037894879 8:22645364-22645386 CTTCAGCCTCTCAAGTGACTGGG - Intronic
1037917887 8:22783746-22783768 CCCCAGACTCACAAGTAACTGGG + Intronic
1038048514 8:23787696-23787718 CTTCAGCCTACCAAGTGGCTGGG + Intergenic
1038549289 8:28451866-28451888 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1038564343 8:28607329-28607351 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1038631855 8:29253086-29253108 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1038825686 8:30998322-30998344 CTTCAGAAAAACATGTAACTAGG + Intronic
1038852432 8:31292901-31292923 CCTCAGACTATCAAGTAGCTGGG + Intergenic
1039362583 8:36895192-36895214 CCTCAGACTTCCAAGTAACTGGG + Intronic
1039577230 8:38633300-38633322 CTTCAGACTCCCAAGTAGCTGGG - Intergenic
1039583800 8:38688416-38688438 CGTCAGCCTCACAAGTAACTGGG - Intergenic
1039900574 8:41749411-41749433 CCTCAGACTACCAAGTAGCTAGG + Intronic
1040021868 8:42748007-42748029 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1040426213 8:47289124-47289146 CTTCAGACTCCCAAGTAGCTGGG + Intronic
1041091643 8:54306928-54306950 CTTCAGTCTCCCAAGTAACTGGG - Intergenic
1041232611 8:55768898-55768920 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1041578738 8:59431986-59432008 CTTCAGCCTCCCAAGTAACTTGG + Intergenic
1042214076 8:66412012-66412034 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1042248898 8:66736733-66736755 CTTCAGCCTACCGAGTGACTGGG + Intronic
1042382776 8:68137381-68137403 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1042918540 8:73899006-73899028 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1043142270 8:76604750-76604772 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1043531353 8:81154580-81154602 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1043552282 8:81387717-81387739 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1043698846 8:83257655-83257677 CCTCAGCCTACCAAGTGGCTGGG - Intergenic
1043742189 8:83828214-83828236 CCTCAGGCTAACAAGTAGCTGGG + Intergenic
1043933145 8:86113364-86113386 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1044071843 8:87770588-87770610 CTTCAGCCTTTCAAGTAACTGGG + Intergenic
1044650023 8:94484309-94484331 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1044981024 8:97716818-97716840 CTTCAGCCTCCCAAGTAACTAGG + Intronic
1045031372 8:98139616-98139638 CTTCAGCCTTTCAAGTGGCTGGG - Intronic
1045742187 8:105374499-105374521 CTTCAGCCTCACAAGTAGCTGGG + Intronic
1046211591 8:111083046-111083068 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1046753773 8:117952644-117952666 CCTCAGCCTCCCAAGTGACTGGG - Intronic
1046936204 8:119887613-119887635 CTTCAGCCTACCAAGTAGCTGGG + Intronic
1046987946 8:120411175-120411197 CCTCAGACTACCAAGTAGCTGGG + Intronic
1047047539 8:121071660-121071682 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
1047273092 8:123381383-123381405 TTTCAGCCTACCAAGTAACTGGG - Intronic
1047485383 8:125325834-125325856 CTTCAGACTACCAAGTAGCTGGG - Intronic
1047607532 8:126489862-126489884 CTGCAGACTCAGAAGAGACTTGG - Intergenic
1047836538 8:128699799-128699821 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1048454279 8:134564037-134564059 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1048835882 8:138518389-138518411 CCTCAGCCTCACAAGTAACTGGG - Intergenic
1049691190 8:143960164-143960186 CTTCAGCCTCACAAGTAGCTGGG - Intronic
1049871544 8:144982523-144982545 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1049919214 9:347388-347410 CCTCAGCCTCACAAGTAACTGGG - Intronic
1049938630 9:523579-523601 CTACAGAATAACAAGGGACCGGG - Intronic
1050351444 9:4744052-4744074 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1051805596 9:20989566-20989588 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1052097079 9:24396319-24396341 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
1052438165 9:28457528-28457550 CCTCAGACTCACTAGTGGCTGGG + Intronic
1052592530 9:30516169-30516191 CTGTAAACTAAAAAGTGACTGGG + Intergenic
1053080736 9:35174438-35174460 CCTCAGACTCCCAAGTAACTGGG + Intronic
1053144232 9:35701391-35701413 CTTCAGACTCATGAGTAACTGGG + Intronic
1053227458 9:36373089-36373111 CTTCAGCCTCACAAGTAGCTGGG - Intronic
1053257648 9:36631688-36631710 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1053361959 9:37494551-37494573 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1053502350 9:38609363-38609385 CCTCAGCCTACCAAGTAACTGGG - Intergenic
1054899128 9:70349180-70349202 CTTCAGACTCCCAAGTAGCTGGG + Intronic
1054920713 9:70539948-70539970 CTTCAGACTCCCAAGTAGCTGGG + Intronic
1055032763 9:71787542-71787564 CCTCAGACTCCCAAGTAACTGGG - Intronic
1055724846 9:79216625-79216647 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1055964627 9:81853428-81853450 CCTCAGCCTCACAAGTAACTGGG - Intergenic
1056166659 9:83947627-83947649 CCTCAGACTGCCAAGTGCCTGGG + Intronic
1056270092 9:84938934-84938956 CTTCAGCCTACCAAGTAGCTGGG - Intronic
1056741834 9:89263220-89263242 CTTCAGCCTCCCAAGTCACTGGG - Intergenic
1057285546 9:93750720-93750742 TTTCAGACAAACAAGTGCCAAGG - Intergenic
1057418303 9:94885231-94885253 CTTCAGCCTACCAAGTAGCTAGG - Intronic
1057681169 9:97187077-97187099 CTTCAGACTCCCAAGTAGCTGGG + Intergenic
1057760735 9:97872184-97872206 CCTCAGACTCAGGAGTGACTGGG + Intergenic
1058417659 9:104805188-104805210 CTTCAGCCTCCCAAGTAACTGGG + Intronic
1058480352 9:105386921-105386943 CTTCAGCCTCCCAAGTAACTCGG - Intronic
1058698663 9:107582686-107582708 CTTCAGCCTCCCAAGTGTCTGGG + Intergenic
1058882357 9:109296769-109296791 CTTCATACTCCCCAGTGACTGGG - Intronic
1059185842 9:112270058-112270080 CTTCAGCCTCACAAGTGGCTGGG + Intronic
1059224857 9:112662674-112662696 CTTCAGACTCTCAAGTAGCTGGG - Exonic
1059254009 9:112912512-112912534 CTTCAGCCTACCAAGTAGCTGGG + Intergenic
1059291875 9:113232726-113232748 CCTCAGCCTACCAAGTGGCTGGG - Intronic
1059382348 9:113936068-113936090 CTTCAGCCTCCCAAGTCACTGGG + Intronic
1059879310 9:118672538-118672560 CCTCAGCCTACCAAGTGGCTGGG + Intergenic
1060093438 9:120765208-120765230 CTTCAGCCTCACAAGTAGCTGGG + Intronic
1060567688 9:124607954-124607976 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1061311083 9:129763010-129763032 CCTCAGACTCCCAAGTGGCTGGG - Intergenic
1061389434 9:130309397-130309419 CTTCAGCCTACCAAGTATCTGGG - Intronic
1061522473 9:131127265-131127287 CTTCAGACTCCCAAGTAGCTGGG - Intronic
1061998152 9:134199001-134199023 CCTCAGCCTACCAAGTGGCTGGG - Intergenic
1062152090 9:135025517-135025539 CCTCAGCCTCCCAAGTGACTGGG + Intergenic
1062497798 9:136839789-136839811 CTTCAGACTGAAGAATGACTCGG + Exonic
1062509237 9:136895731-136895753 CTTCAGCCTCCCAAGTAACTGGG - Intronic
1062510027 9:136900049-136900071 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1062626452 9:137444946-137444968 CTTCAGACTCCCAAGTAGCTGGG - Intergenic
1185972088 X:4676394-4676416 CTCCAGTCTAAAAAGTGTCTAGG + Intergenic
1186024740 X:5297032-5297054 CTTCAGCCTTCCAAGTAACTGGG - Intergenic
1186221590 X:7355017-7355039 CTTCAGCCTCCCAAGTCACTGGG + Intergenic
1186252956 X:7688722-7688744 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1186386341 X:9113918-9113940 CCTCAGCCTCACAAGTAACTGGG + Intronic
1186554521 X:10543725-10543747 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1186753197 X:12642785-12642807 CTTCAGCCTACCAAGCAACTGGG - Intronic
1186979646 X:14945310-14945332 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1187053984 X:15723807-15723829 CTTCAGACTCCCAAGTAGCTGGG + Intronic
1187145937 X:16637332-16637354 CTTCAGCCTCCCAAGTGGCTGGG + Intronic
1187694646 X:21906430-21906452 CTTCAGAGACACAAGTGAATGGG + Intergenic
1187902522 X:24038000-24038022 CTTCAGCCTCACAAGTAGCTGGG - Intergenic
1187904323 X:24051912-24051934 CTTCAGCCTGCCAAGTAACTGGG - Intergenic
1188054758 X:25528086-25528108 CCTCAGCCTAACAAGTAGCTGGG - Intergenic
1188153232 X:26705647-26705669 CTTCAGCCTCCCAAGTAACTGGG - Intergenic
1189339351 X:40192837-40192859 CCTCAGCCTCACAAGTAACTGGG - Intergenic
1189651708 X:43196847-43196869 CTTCAGACTCCCAAGTAGCTGGG - Intergenic
1189674142 X:43443803-43443825 CTACAGAGTAGGAAGTGACTAGG - Intergenic
1190015819 X:46826198-46826220 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1190120590 X:47656211-47656233 CTTCAGCCTGCCAAGTAACTGGG - Intronic
1190489486 X:50967249-50967271 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
1191055975 X:56241279-56241301 CCTCAGCCTACCAAGTGGCTGGG + Intronic
1191668754 X:63729778-63729800 GCTCAGACTTACAAGTGAGTGGG + Intronic
1192107456 X:68329031-68329053 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1192251998 X:69421508-69421530 CTTCAGCCTGCCAAGTGCCTGGG + Intergenic
1192361274 X:70441673-70441695 CCTCAGCCTCACAAGTGGCTGGG - Intergenic
1192377419 X:70577841-70577863 CTTCAGCCTACCAAGTAGCTGGG + Intronic
1193333489 X:80261509-80261531 CTTCAGCCTCACAAGTAGCTGGG + Intergenic
1193598521 X:83478821-83478843 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1193707007 X:84833541-84833563 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1194193451 X:90865029-90865051 CTTAAGACTACCAAGTTGCTGGG + Intergenic
1194690052 X:96973380-96973402 CTTCAGTCTCTCAAGTAACTGGG - Intronic
1195311352 X:103634495-103634517 CTTCAGCCTCCCAAGTGAGTGGG - Intergenic
1195642070 X:107186780-107186802 CTTCAGCCTCCCAAGTGGCTGGG - Intronic
1196560345 X:117139652-117139674 CTTCAGCCTACCAAGTAGCTGGG - Intergenic
1196681940 X:118478548-118478570 CCTCAGCCTCACAAGTAACTGGG + Intergenic
1196686808 X:118517265-118517287 CCTCAGACTCACAAGTAGCTAGG - Intronic
1196997396 X:121399432-121399454 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1197403240 X:126019722-126019744 CATCAGACTGACAAGTGACAAGG - Intergenic
1197698211 X:129573668-129573690 CCTCAGCCTCCCAAGTGACTGGG + Intronic
1198012981 X:132578239-132578261 CTTCAGCCTCCCAAGTGGCTGGG - Intergenic
1198194555 X:134346743-134346765 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1198809040 X:140516689-140516711 CCTCAGCCTACCAAGTAACTGGG - Intergenic
1199012835 X:142777604-142777626 CCTCAGCCTACCAAGTAACTGGG - Intergenic
1199194965 X:145017713-145017735 CTTCAGCCTCCCAAGTGGCTGGG + Intergenic
1199899136 X:152156018-152156040 CTCCTGACATACAAGTGACTGGG + Intergenic
1200540061 Y:4447416-4447438 CTTAAGACTACCAAGTTGCTGGG + Intergenic
1201271007 Y:12253707-12253729 CTTCAGCCTCCCAAGTAACTGGG + Intergenic
1201340601 Y:12928843-12928865 CTTCAGCCTCCCAAGTAACTAGG - Intergenic
1201391282 Y:13500067-13500089 CCTCAGCCTCCCAAGTGACTGGG - Intergenic
1201563998 Y:15347164-15347186 CATCAGTCTACCAAGTAACTGGG + Intergenic
1201683406 Y:16674445-16674467 CCTCAGACTCCCAAGTAACTGGG + Intergenic
1201949398 Y:19547421-19547443 CTTCAGCCTTCCAAGTGGCTGGG + Intergenic