ID: 1037770994

View in Genome Browser
Species Human (GRCh38)
Location 8:21799746-21799768
Sequence CAAGCTAATCCCCCTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037770988_1037770994 21 Left 1037770988 8:21799702-21799724 CCAAGTCACTTGTTAGTCTGAAG 0: 1
1: 0
2: 0
3: 24
4: 1011
Right 1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG No data
1037770987_1037770994 30 Left 1037770987 8:21799693-21799715 CCTAGTGAACCAAGTCACTTGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037770994 Original CRISPR CAAGCTAATCCCCCTGAAGT GGG Intronic
No off target data available for this crispr