ID: 1037775825

View in Genome Browser
Species Human (GRCh38)
Location 8:21835003-21835025
Sequence ATGGAAAAGCACATCGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037775825_1037775834 18 Left 1037775825 8:21835003-21835025 CCATCCTCGATGTGCTTTTCCAT No data
Right 1037775834 8:21835044-21835066 ATAAGCCAGCCTCCAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037775825 Original CRISPR ATGGAAAAGCACATCGAGGA TGG (reversed) Intergenic
No off target data available for this crispr