ID: 1037776288

View in Genome Browser
Species Human (GRCh38)
Location 8:21838120-21838142
Sequence CATAAATAGAAGTGGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037776288_1037776296 11 Left 1037776288 8:21838120-21838142 CCCTGAATCCACTTCTATTTATG No data
Right 1037776296 8:21838154-21838176 GCGTAATTGTTTCATTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037776288 Original CRISPR CATAAATAGAAGTGGATTCA GGG (reversed) Intergenic
No off target data available for this crispr