ID: 1037779311

View in Genome Browser
Species Human (GRCh38)
Location 8:21856766-21856788
Sequence CATCCTCAAGCGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037779303_1037779311 22 Left 1037779303 8:21856721-21856743 CCACATTAAGCTCAATTATATTT No data
Right 1037779311 8:21856766-21856788 CATCCTCAAGCGAAGGGGGCAGG No data
1037779302_1037779311 26 Left 1037779302 8:21856717-21856739 CCATCCACATTAAGCTCAATTAT No data
Right 1037779311 8:21856766-21856788 CATCCTCAAGCGAAGGGGGCAGG No data
1037779306_1037779311 -8 Left 1037779306 8:21856751-21856773 CCTTTTGACAGAATTCATCCTCA No data
Right 1037779311 8:21856766-21856788 CATCCTCAAGCGAAGGGGGCAGG No data
1037779301_1037779311 29 Left 1037779301 8:21856714-21856736 CCTCCATCCACATTAAGCTCAAT No data
Right 1037779311 8:21856766-21856788 CATCCTCAAGCGAAGGGGGCAGG No data
1037779305_1037779311 -7 Left 1037779305 8:21856750-21856772 CCCTTTTGACAGAATTCATCCTC No data
Right 1037779311 8:21856766-21856788 CATCCTCAAGCGAAGGGGGCAGG No data
1037779304_1037779311 -6 Left 1037779304 8:21856749-21856771 CCCCTTTTGACAGAATTCATCCT No data
Right 1037779311 8:21856766-21856788 CATCCTCAAGCGAAGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037779311 Original CRISPR CATCCTCAAGCGAAGGGGGC AGG Intergenic
No off target data available for this crispr