ID: 1037782703

View in Genome Browser
Species Human (GRCh38)
Location 8:21881666-21881688
Sequence GCTATAGGGTTCACCCTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037782696_1037782703 6 Left 1037782696 8:21881637-21881659 CCTGTGACAGAGAGGACACCTGG No data
Right 1037782703 8:21881666-21881688 GCTATAGGGTTCACCCTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037782703 Original CRISPR GCTATAGGGTTCACCCTGTC CGG Intergenic