ID: 1037784487

View in Genome Browser
Species Human (GRCh38)
Location 8:21894540-21894562
Sequence TAACGCCTCCATGAAATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037784487_1037784490 -4 Left 1037784487 8:21894540-21894562 CCTGGCATTTCATGGAGGCGTTA No data
Right 1037784490 8:21894559-21894581 GTTACTAGGCCTGGAATCTCAGG No data
1037784487_1037784492 7 Left 1037784487 8:21894540-21894562 CCTGGCATTTCATGGAGGCGTTA No data
Right 1037784492 8:21894570-21894592 TGGAATCTCAGGTGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037784487 Original CRISPR TAACGCCTCCATGAAATGCC AGG (reversed) Intergenic
No off target data available for this crispr