ID: 1037784545

View in Genome Browser
Species Human (GRCh38)
Location 8:21894867-21894889
Sequence TCTGCTTTCAGAGGTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037784545_1037784550 -5 Left 1037784545 8:21894867-21894889 CCTGGGGGACCTCTGAAAGCAGA No data
Right 1037784550 8:21894885-21894907 GCAGAGGGTGCTGAACCCATGGG No data
1037784545_1037784554 23 Left 1037784545 8:21894867-21894889 CCTGGGGGACCTCTGAAAGCAGA No data
Right 1037784554 8:21894913-21894935 TAACGCCTCCATGAAATGCCAGG No data
1037784545_1037784549 -6 Left 1037784545 8:21894867-21894889 CCTGGGGGACCTCTGAAAGCAGA No data
Right 1037784549 8:21894884-21894906 AGCAGAGGGTGCTGAACCCATGG No data
1037784545_1037784555 26 Left 1037784545 8:21894867-21894889 CCTGGGGGACCTCTGAAAGCAGA No data
Right 1037784555 8:21894916-21894938 CGCCTCCATGAAATGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037784545 Original CRISPR TCTGCTTTCAGAGGTCCCCC AGG (reversed) Intergenic