ID: 1037784548

View in Genome Browser
Species Human (GRCh38)
Location 8:21894876-21894898
Sequence TCAGCACCCTCTGCTTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037784548_1037784554 14 Left 1037784548 8:21894876-21894898 CCTCTGAAAGCAGAGGGTGCTGA No data
Right 1037784554 8:21894913-21894935 TAACGCCTCCATGAAATGCCAGG No data
1037784548_1037784555 17 Left 1037784548 8:21894876-21894898 CCTCTGAAAGCAGAGGGTGCTGA No data
Right 1037784555 8:21894916-21894938 CGCCTCCATGAAATGCCAGGAGG No data
1037784548_1037784559 25 Left 1037784548 8:21894876-21894898 CCTCTGAAAGCAGAGGGTGCTGA No data
Right 1037784559 8:21894924-21894946 TGAAATGCCAGGAGGCCTCTGGG No data
1037784548_1037784558 24 Left 1037784548 8:21894876-21894898 CCTCTGAAAGCAGAGGGTGCTGA No data
Right 1037784558 8:21894923-21894945 ATGAAATGCCAGGAGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037784548 Original CRISPR TCAGCACCCTCTGCTTTCAG AGG (reversed) Intergenic