ID: 1037784551

View in Genome Browser
Species Human (GRCh38)
Location 8:21894900-21894922
Sequence GGAGGCGTTACTAGGCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037784551_1037784561 9 Left 1037784551 8:21894900-21894922 CCCATGGGCCTAGTAACGCCTCC No data
Right 1037784561 8:21894932-21894954 CAGGAGGCCTCTGGGAGCTGAGG No data
1037784551_1037784554 -10 Left 1037784551 8:21894900-21894922 CCCATGGGCCTAGTAACGCCTCC No data
Right 1037784554 8:21894913-21894935 TAACGCCTCCATGAAATGCCAGG No data
1037784551_1037784559 1 Left 1037784551 8:21894900-21894922 CCCATGGGCCTAGTAACGCCTCC No data
Right 1037784559 8:21894924-21894946 TGAAATGCCAGGAGGCCTCTGGG No data
1037784551_1037784555 -7 Left 1037784551 8:21894900-21894922 CCCATGGGCCTAGTAACGCCTCC No data
Right 1037784555 8:21894916-21894938 CGCCTCCATGAAATGCCAGGAGG No data
1037784551_1037784565 25 Left 1037784551 8:21894900-21894922 CCCATGGGCCTAGTAACGCCTCC No data
Right 1037784565 8:21894948-21894970 GCTGAGGACTGGGCCACCCCTGG No data
1037784551_1037784563 15 Left 1037784551 8:21894900-21894922 CCCATGGGCCTAGTAACGCCTCC No data
Right 1037784563 8:21894938-21894960 GCCTCTGGGAGCTGAGGACTGGG No data
1037784551_1037784558 0 Left 1037784551 8:21894900-21894922 CCCATGGGCCTAGTAACGCCTCC No data
Right 1037784558 8:21894923-21894945 ATGAAATGCCAGGAGGCCTCTGG No data
1037784551_1037784562 14 Left 1037784551 8:21894900-21894922 CCCATGGGCCTAGTAACGCCTCC No data
Right 1037784562 8:21894937-21894959 GGCCTCTGGGAGCTGAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037784551 Original CRISPR GGAGGCGTTACTAGGCCCAT GGG (reversed) Intergenic