ID: 1037784554

View in Genome Browser
Species Human (GRCh38)
Location 8:21894913-21894935
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037784548_1037784554 14 Left 1037784548 8:21894876-21894898 CCTCTGAAAGCAGAGGGTGCTGA No data
Right 1037784554 8:21894913-21894935 TAACGCCTCCATGAAATGCCAGG No data
1037784551_1037784554 -10 Left 1037784551 8:21894900-21894922 CCCATGGGCCTAGTAACGCCTCC No data
Right 1037784554 8:21894913-21894935 TAACGCCTCCATGAAATGCCAGG No data
1037784545_1037784554 23 Left 1037784545 8:21894867-21894889 CCTGGGGGACCTCTGAAAGCAGA No data
Right 1037784554 8:21894913-21894935 TAACGCCTCCATGAAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037784554 Original CRISPR TAACGCCTCCATGAAATGCC AGG Intergenic
No off target data available for this crispr