ID: 1037788812

View in Genome Browser
Species Human (GRCh38)
Location 8:21919331-21919353
Sequence GCCGAGGTCTGTCGCCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037788812_1037788822 16 Left 1037788812 8:21919331-21919353 CCGGGGCGGCGACAGACCTCGGC No data
Right 1037788822 8:21919370-21919392 TCACCACGCAAACGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037788812 Original CRISPR GCCGAGGTCTGTCGCCGCCC CGG (reversed) Intergenic
No off target data available for this crispr