ID: 1037799838

View in Genome Browser
Species Human (GRCh38)
Location 8:22026327-22026349
Sequence AACCATTCACTGCTAGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037799837_1037799838 4 Left 1037799837 8:22026300-22026322 CCACAATGATTGGAGACTGCTGC 0: 1
1: 1
2: 6
3: 73
4: 502
Right 1037799838 8:22026327-22026349 AACCATTCACTGCTAGTGACAGG No data
1037799835_1037799838 12 Left 1037799835 8:22026292-22026314 CCCTGGTTCCACAATGATTGGAG 0: 1
1: 0
2: 2
3: 51
4: 392
Right 1037799838 8:22026327-22026349 AACCATTCACTGCTAGTGACAGG No data
1037799836_1037799838 11 Left 1037799836 8:22026293-22026315 CCTGGTTCCACAATGATTGGAGA 0: 1
1: 0
2: 1
3: 45
4: 415
Right 1037799838 8:22026327-22026349 AACCATTCACTGCTAGTGACAGG No data
1037799832_1037799838 25 Left 1037799832 8:22026279-22026301 CCAGGAAACCATTCCCTGGTTCC 0: 1
1: 1
2: 20
3: 545
4: 1275
Right 1037799838 8:22026327-22026349 AACCATTCACTGCTAGTGACAGG No data
1037799833_1037799838 17 Left 1037799833 8:22026287-22026309 CCATTCCCTGGTTCCACAATGAT 0: 1
1: 0
2: 1
3: 22
4: 387
Right 1037799838 8:22026327-22026349 AACCATTCACTGCTAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037799838 Original CRISPR AACCATTCACTGCTAGTGAC AGG Intronic
No off target data available for this crispr