ID: 1037799932

View in Genome Browser
Species Human (GRCh38)
Location 8:22027201-22027223
Sequence CCTCATGCACTGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037799925_1037799932 16 Left 1037799925 8:22027162-22027184 CCTATAAGTGATAGTATTTAGGT 0: 1
1: 0
2: 1
3: 13
4: 101
Right 1037799932 8:22027201-22027223 CCTCATGCACTGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037799932 Original CRISPR CCTCATGCACTGAGGGTGGA GGG Intronic
No off target data available for this crispr