ID: 1037802683

View in Genome Browser
Species Human (GRCh38)
Location 8:22043988-22044010
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037802672_1037802683 6 Left 1037802672 8:22043959-22043981 CCTTTTCTCTGGGAGAGGGAAAG 0: 1
1: 0
2: 2
3: 40
4: 378
Right 1037802683 8:22043988-22044010 CCTTTGAAGCAGTGGGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr