ID: 1037802790

View in Genome Browser
Species Human (GRCh38)
Location 8:22044335-22044357
Sequence CAGCTGTCTGCAGTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037802782_1037802790 14 Left 1037802782 8:22044298-22044320 CCGGACCACAGCCATGCTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG No data
1037802786_1037802790 9 Left 1037802786 8:22044303-22044325 CCACAGCCATGCTTGAGGGGCTG 0: 1
1: 0
2: 2
3: 17
4: 189
Right 1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG No data
1037802787_1037802790 3 Left 1037802787 8:22044309-22044331 CCATGCTTGAGGGGCTGTCTGAC 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG No data
1037802781_1037802790 22 Left 1037802781 8:22044290-22044312 CCAGCAGGCCGGACCACAGCCAT 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037802790 Original CRISPR CAGCTGTCTGCAGTGGTGGA AGG Intronic
No off target data available for this crispr