ID: 1037803031

View in Genome Browser
Species Human (GRCh38)
Location 8:22045295-22045317
Sequence GCCCAATGGCTGCCCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037803031_1037803036 4 Left 1037803031 8:22045295-22045317 CCTGCCAGGGGCAGCCATTGGGC 0: 1
1: 0
2: 1
3: 23
4: 238
Right 1037803036 8:22045322-22045344 GCTGATAGTGCCTGTCCTCTTGG 0: 1
1: 0
2: 1
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037803031 Original CRISPR GCCCAATGGCTGCCCCTGGC AGG (reversed) Intronic
900563085 1:3317670-3317692 GCCCAATGGCTGCCCTCAGACGG - Intronic
900687106 1:3955602-3955624 GCCTAGTGGCTGCCCACGGCCGG + Intergenic
902159416 1:14518042-14518064 GCCCAAGGTCTGCCACTGACTGG + Intergenic
902291818 1:15440370-15440392 GCCCCACAGCTGGCCCTGGCAGG + Exonic
902294490 1:15457153-15457175 GCCCAACAGCTGGCCCTGGCAGG + Exonic
902297313 1:15476524-15476546 GCCCAACAGCTGGCCCTGGCAGG + Exonic
902439854 1:16422099-16422121 TCCCAGTGGCTGGCCATGGCTGG + Intronic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
902974554 1:20079630-20079652 GCACAATGGCTCACCCTGGGAGG - Intronic
903057791 1:20648500-20648522 CCCAGACGGCTGCCCCTGGCTGG + Exonic
908036677 1:60061993-60062015 GGCCAATGGGTAGCCCTGGCAGG + Intronic
908612822 1:65881358-65881380 ACCCCATGGCTGCCCCAGCCAGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
916074602 1:161193237-161193259 GCCCAGTGCCTGGGCCTGGCAGG + Exonic
919907232 1:202086262-202086284 GCACTATGGCTGCCTCTGACTGG - Intergenic
921246770 1:213251458-213251480 GCACAATGACTGCCTCTGGAAGG - Intronic
921401451 1:214727863-214727885 CCCTAATGGCTTCCCTTGGCTGG + Intergenic
922218840 1:223542546-223542568 GGCCAATGCCTCCCCCTGCCTGG + Intronic
922782441 1:228263896-228263918 CACCAAGGGCTGCCCCAGGCAGG - Intronic
924624154 1:245686166-245686188 GCCCATGGGCTCCCCCCGGCTGG + Exonic
1062857801 10:788112-788134 GCCCAGTGGCTGGCCCAGCCTGG - Intergenic
1063672730 10:8112425-8112447 GCCCAGTGGCAGGCCGTGGCTGG - Intergenic
1066064216 10:31750506-31750528 GCCCAGCGGCTGCCCAGGGCCGG - Intergenic
1067222487 10:44353934-44353956 TCCCCATGGCTGCCCATGGCAGG + Intergenic
1067781038 10:49207716-49207738 ACTCAATGCCTGCCCCTGGCAGG + Intergenic
1068069939 10:52183228-52183250 GCCCGTGGGCTGCCCCAGGCAGG - Intronic
1068111321 10:52684090-52684112 GCCCAATGGGTTCACCTTGCTGG + Intergenic
1070632405 10:78096293-78096315 CCCTAATGGCTTCCCTTGGCTGG - Intergenic
1071189992 10:83089115-83089137 CCCCAATGGCTTCCCTTGGCTGG - Intergenic
1076692329 10:132230264-132230286 AGCCCCTGGCTGCCCCTGGCAGG + Intronic
1077217463 11:1400905-1400927 GCCCAGTGGCTGCCGGCGGCGGG + Intronic
1078666945 11:13333645-13333667 GCGCAGTGGCTGCCCATGACAGG + Intronic
1078758705 11:14234633-14234655 GCCCAAGGGCTGCCTCCGGTGGG - Intronic
1080285707 11:30608675-30608697 GGCCAATGGGAGCCACTGGCTGG + Intergenic
1081538711 11:44014690-44014712 ACCCTAGGGCAGCCCCTGGCAGG + Intergenic
1081871149 11:46383055-46383077 GACCAAATGCTGCCCGTGGCTGG - Intronic
1083226957 11:61291291-61291313 TCCCAATGTCTGCTCCTGCCAGG - Exonic
1083800646 11:65044536-65044558 GCCCACGGGCTGCCCTTGGACGG + Exonic
1084175266 11:67419498-67419520 GCTCAGTGGCTGGCGCTGGCGGG + Exonic
1084187781 11:67483950-67483972 GCACAGGGGCTGCCCCTGGGAGG - Intronic
1084209768 11:67615546-67615568 GCCAAGTGGGTGCCCCAGGCTGG + Intergenic
1084213487 11:67634525-67634547 TCCCTGTGGCTGCACCTGGCTGG + Intronic
1084301878 11:68257560-68257582 GTCCAAGGGCTCCCCCTGGCGGG - Intergenic
1084426492 11:69087021-69087043 GCCCTGTGGCTGACCCTGGAGGG + Intronic
1084557509 11:69883735-69883757 GGACAATAGCTGCCTCTGGCCGG + Intergenic
1085299046 11:75447915-75447937 CCCCACTGGCTGCCTCTGGGAGG + Intronic
1088058061 11:105609915-105609937 GGCAAAGGGCAGCCCCTGGCGGG - Intergenic
1088409876 11:109522566-109522588 GCCCACAGGCTGCCACTAGCAGG - Intergenic
1089494051 11:118899620-118899642 CACCACTGGCTTCCCCTGGCTGG + Intronic
1090188933 11:124756031-124756053 ACACAATACCTGCCCCTGGCAGG + Intronic
1090193260 11:124791800-124791822 ACACAATACCTGCCCCTGGCGGG - Intronic
1091564085 12:1635106-1635128 GCCCAAAGGCTGCCCCGTGAAGG + Intronic
1091836194 12:3587930-3587952 GCCCACTGGCTGCCACAGCCTGG - Intronic
1091851029 12:3696982-3697004 TCGCGATGGCTGCCCCTGACGGG - Exonic
1092062254 12:5561082-5561104 GCCCACTGGCTGCTCATGGCTGG - Intronic
1094219059 12:27974209-27974231 GCCAGATGCCTGCCCTTGGCTGG + Intergenic
1095694801 12:45132458-45132480 CCCTAATGGCTTCCCTTGGCTGG - Intergenic
1096109722 12:49021509-49021531 GCCCAATGGCTGCTTCTGTCTGG + Exonic
1097375880 12:58841587-58841609 CCCTAATGGCTTTCCCTGGCTGG + Intergenic
1101737006 12:107470720-107470742 TCCCAATGCCTGGCTCTGGCTGG + Intronic
1102028404 12:109726515-109726537 GCCCCATGGCTGCCCGGGGTGGG - Intronic
1102920032 12:116784958-116784980 GCACAAGGGCAGCCCCTGGAGGG - Intronic
1103342544 12:120228817-120228839 ACCCCATGGCTGCACCTGGTCGG + Intronic
1103764354 12:123270765-123270787 CCCCAAGGGCTGGCCCTGGAAGG - Intronic
1103988146 12:124780771-124780793 GCCCCATGGCTGCACCTCCCTGG - Intronic
1104003750 12:124877757-124877779 GCACAGTGGCTGCCTCTGTCTGG - Intronic
1104859352 12:131916525-131916547 GCCCAACGGCTGACCATGGAAGG - Exonic
1105337505 13:19487306-19487328 TCCCACAGGCTGCCCCTAGCAGG - Intronic
1106771715 13:32967706-32967728 GCCCAATCGGTGCTGCTGGCAGG - Intergenic
1108493641 13:51004448-51004470 GAACATCGGCTGCCCCTGGCAGG + Intergenic
1110572595 13:77022564-77022586 GCCCAGTGCCTGTCCGTGGCAGG - Intronic
1113030836 13:105991981-105992003 GCCCAGTGGATGCCCCTGGAAGG - Intergenic
1113400273 13:109985988-109986010 TCCCACTGCCTGACCCTGGCAGG + Intergenic
1113587862 13:111477400-111477422 GCCCTTTGGCTCACCCTGGCAGG - Intergenic
1116172880 14:41426025-41426047 GCCCAATGGGTTCACCTTGCTGG + Intergenic
1118008817 14:61589761-61589783 GATCAATGCCTGCCGCTGGCAGG - Intronic
1118339335 14:64880695-64880717 GCCCACTGGCACCTCCTGGCCGG + Intergenic
1118721397 14:68596835-68596857 TGCCAATGTCTGCCCCTGACGGG - Intronic
1119027426 14:71165251-71165273 GCCCAAGGGCAAGCCCTGGCAGG - Intergenic
1120697332 14:87659127-87659149 AGCCAATGGCTGCCCATGGAGGG + Intergenic
1122961619 14:105096453-105096475 GTCCCATGGCTGCCCCAGGGAGG + Intergenic
1123704957 15:22944700-22944722 GCCCAGCGGCTGCTTCTGGCTGG - Intronic
1128526388 15:68415084-68415106 GCCAAATGACTACCCCTGGGTGG + Intronic
1128737653 15:70062351-70062373 TCGCACTGGCTGCCCCTTGCAGG + Intronic
1130404419 15:83585175-83585197 GCCCAATGCTTGCACCTAGCAGG - Intronic
1132392892 15:101451581-101451603 TCCCAAAGCCTGCCCTTGGCTGG + Intronic
1132556242 16:573965-573987 GCCCTGTGGCTGCACCTGTCAGG + Intronic
1133309130 16:4831557-4831579 GCACAAGGGCTGGCCCTGGGAGG - Intronic
1133428279 16:5712416-5712438 GCCCAATAACTGGTCCTGGCAGG - Intergenic
1135564417 16:23500503-23500525 GCCCAATGCCAGCCCCAAGCGGG + Intronic
1138476579 16:57273744-57273766 GACCAATGCCTGTCCCTGCCAGG + Intronic
1139959793 16:70710948-70710970 CCAGAATGGCAGCCCCTGGCCGG - Intronic
1140182651 16:72736074-72736096 GCACTCTGGCTGCCCCTTGCTGG + Intergenic
1141768746 16:86075762-86075784 GACCCAGTGCTGCCCCTGGCTGG + Intergenic
1144786377 17:17834609-17834631 GCCACATGGCTGCCCATGCCTGG + Intronic
1146377277 17:32303180-32303202 GCCCCAGGGCAGCCCCAGGCAGG - Intronic
1146620045 17:34390161-34390183 TCCCAGTGGCTGCCTGTGGCTGG + Intergenic
1146695141 17:34903132-34903154 GCCCACCCACTGCCCCTGGCTGG - Intergenic
1148779371 17:50112847-50112869 AGCCAGTGGCTGCCCCTGCCGGG + Exonic
1151311213 17:73293465-73293487 GACCAGAGGCTGCCCCTGGAAGG - Intronic
1151894189 17:76969126-76969148 GCCAAATAGCTGCCCGGGGCGGG + Intergenic
1151894723 17:76972298-76972320 GCCCCATACCTGCCCCAGGCTGG + Intergenic
1152096224 17:78273225-78273247 GGCAAATGGCTACCACTGGCAGG - Intergenic
1152217497 17:79042320-79042342 GCCCAAGTGCCGCCCCTCGCGGG + Intronic
1152466464 17:80469526-80469548 GCCCACAAGCTGCCACTGGCCGG - Exonic
1152582102 17:81170750-81170772 GCCCCAAGGATGCCCCTGCCTGG + Intergenic
1152702209 17:81824708-81824730 GCCCACTGGCTGCCTGTGGCTGG - Exonic
1153948241 18:10035554-10035576 GGCCAGTGAGTGCCCCTGGCTGG - Intergenic
1154309978 18:13259889-13259911 GCCCAATGGAGGCCCCAGGAGGG + Intronic
1158120488 18:54042972-54042994 TCCCAGGGGCTGCCCCTCGCAGG - Intergenic
1158184811 18:54759829-54759851 GCTAAACGGCTGTCCCTGGCTGG - Intronic
1158560147 18:58506613-58506635 CCCCAACGGCTGACCCTGGAAGG - Intronic
1160187089 18:76684375-76684397 GCCCCACGGCTCCTCCTGGCAGG + Intergenic
1160543355 18:79637765-79637787 ACCCAGAGGCAGCCCCTGGCCGG - Intergenic
1160919799 19:1514011-1514033 GCCCCACGGCGCCCCCTGGCGGG + Intergenic
1161234942 19:3193131-3193153 GCCCAGTGACTGTCCCTGGAGGG - Intronic
1161234955 19:3193165-3193187 GCCCAGTGACTGTCCCTGGAGGG - Intronic
1161234968 19:3193199-3193221 GCCCAGTGACTGTCCCTGGTGGG - Intronic
1161589173 19:5121066-5121088 ACCCCACGGCTGCCCCTGGCAGG - Intronic
1162060484 19:8091688-8091710 GCCCCACTGCAGCCCCTGGCTGG - Intronic
1162271798 19:9621745-9621767 GCAGAATGGGTGCCACTGGCTGG + Intronic
1168266682 19:55227396-55227418 GCCCATAGGCTGCCACCGGCAGG + Exonic
925058219 2:871712-871734 GGCCAATGGATGCCACTGGAGGG + Intergenic
925149277 2:1603341-1603363 GTCCAATGGCAGCCCCAGCCTGG - Intergenic
926109600 2:10173523-10173545 GCCCAATGCAGGCCCGTGGCTGG + Intronic
926114672 2:10204885-10204907 ACCCAAGGTCTGCACCTGGCTGG - Intronic
928087854 2:28356848-28356870 TCCCAACAGCTGACCCTGGCAGG + Intergenic
930991164 2:57656239-57656261 GCCGAATAGCAGCCCCTGGAAGG - Intergenic
932904883 2:75738844-75738866 TCCCATAGGCTGCCCTTGGCAGG + Intergenic
935046865 2:99490235-99490257 GCCCAGGCGCTGCCCCTTGCGGG - Intergenic
936271645 2:111053783-111053805 GTCCCATGGAGGCCCCTGGCTGG - Intronic
937153443 2:119701617-119701639 GCCCAATGGGTTCACCTTGCTGG + Intergenic
938312224 2:130301034-130301056 GGCCACTGCCTGCCACTGGCTGG + Intergenic
939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG + Intergenic
940594071 2:155767283-155767305 CCCTAATGGCTTCCCTTGGCTGG + Intergenic
940807534 2:158204998-158205020 GCCCATGGGATGCCCATGGCTGG - Intronic
941641748 2:167996452-167996474 GCCCCATGGCTGCCCCTGCCAGG - Intronic
947873396 2:233452359-233452381 GCACAAGGGCAGCTCCTGGCAGG - Intronic
948364301 2:237444694-237444716 CCACACTGGCTGCCTCTGGCTGG - Intergenic
948638978 2:239361144-239361166 CCCCTCTGCCTGCCCCTGGCTGG + Intronic
948712478 2:239833655-239833677 CACCCATGGCTGTCCCTGGCCGG + Intergenic
948978313 2:241478331-241478353 GCCCTAAGGCTGCCCCAGGCAGG - Intronic
1171186301 20:23126510-23126532 GCTCAGTGGCTGCCTGTGGCTGG + Intergenic
1171309445 20:24134795-24134817 CCCCAGTGGCTGCTCCAGGCTGG - Intergenic
1173738889 20:45381751-45381773 GAACAATGGCTGCCACGGGCTGG - Intronic
1173837389 20:46134864-46134886 GCCCACTGGCTGTAGCTGGCTGG - Intergenic
1175497034 20:59422412-59422434 GCCCAAAGGCTGGCCCAGGTTGG - Intergenic
1176736141 21:10548494-10548516 TCCCCAGGGCTTCCCCTGGCAGG + Intronic
1178391944 21:32205985-32206007 GGCCAATGCCTTTCCCTGGCTGG + Intergenic
1179613793 21:42569000-42569022 GCACAGTGGCTGCACCTGCCAGG + Intronic
1180787262 22:18553941-18553963 GCCCACTGCCTGGCCCTGTCGGG + Intergenic
1180787635 22:18555880-18555902 GCCCACTGCCTGGCCCTGACAGG + Intergenic
1181092640 22:20484539-20484561 GCACAATGGGTGCCCAAGGCCGG - Intronic
1181138548 22:20786695-20786717 GTGCAACGGCTGCCCCTGACAGG + Intronic
1181234104 22:21439426-21439448 GCCCACTGCCTGGCCCTGACAGG - Intronic
1181234478 22:21441365-21441387 GCCCACTGCCTGGCCCTGACGGG - Intronic
1181244170 22:21493466-21493488 GCCCACTGCCTGGCCCTGTCGGG + Intergenic
1181244543 22:21495405-21495427 GCCCACTGCCTGGCCCTGACAGG + Intergenic
1181694215 22:24584943-24584965 GTCCTAGGGCTGCCCTTGGCAGG - Intronic
1182109905 22:27715630-27715652 CCTCAATGGCTGCCCCAGGAAGG - Intergenic
1182711128 22:32323962-32323984 TCCCGATGGCTGCCCCTGTGTGG + Intergenic
1183506187 22:38210241-38210263 CCACAGTGGCTGCCCCTGTCAGG + Intronic
1183638351 22:39078370-39078392 CCCCAATGGCTGCCTCCTGCAGG + Intronic
1184340104 22:43881308-43881330 GCCCAGTGACTGCACCTGGCAGG + Intronic
1184422496 22:44390162-44390184 CCCCAAGGTCTGGCCCTGGCAGG - Intergenic
1184477648 22:44730092-44730114 CCCCCAGGGCTGCCCCTGGCGGG + Intronic
1184784098 22:46663495-46663517 GGCCTATGGCAGCACCTGGCAGG - Intronic
1185180537 22:49358280-49358302 GCCCAGAGGCTGCCTGTGGCGGG + Intergenic
1185312757 22:50165744-50165766 GCCCAGATGCTGCCCCAGGCAGG + Intergenic
949846055 3:8372027-8372049 CCCTAATGGCTTCCCTTGGCTGG - Intergenic
950897954 3:16470396-16470418 GCCCAAGGGCAGGCCCTGGTTGG + Intronic
953374492 3:42417250-42417272 GGCCCAGGGCTGCCACTGGCTGG - Intergenic
961450895 3:127001860-127001882 GCCCAGAGGCTGGTCCTGGCTGG + Intronic
967638546 3:191834389-191834411 CCCTAATGGCTTCCCTTGGCTGG - Intergenic
968453134 4:684380-684402 GCCCAGTGTCCGACCCTGGCGGG - Intronic
968833777 4:2948038-2948060 TCCCCATGCCTGCCTCTGGCTGG + Intronic
969284532 4:6194708-6194730 ACCCACTGGCAGTCCCTGGCTGG + Intronic
969459582 4:7321906-7321928 CCCCCATGGCTGCCCCTTGCAGG - Intronic
969567279 4:7985948-7985970 GCCCACTTCCTGCCCCTTGCTGG + Intronic
969721376 4:8894467-8894489 ACCCCATGGCAGCGCCTGGCAGG - Intergenic
970272798 4:14365297-14365319 GCCCAATAGCAGCCCCAGCCTGG - Intergenic
971230888 4:24799706-24799728 GGCCGACGGCTGCACCTGGCAGG - Exonic
985749541 5:1666486-1666508 GCCCCTGGGCTGCCCCTGGAGGG + Intergenic
986083978 5:4424452-4424474 GCCCCATGGCTGCCCTCGGCTGG + Intergenic
986456630 5:7926994-7927016 ACCCCATGGCTGGCGCTGGCAGG + Intergenic
988788514 5:34585895-34585917 GGCGAATGGCAGCACCTGGCTGG + Intergenic
989675315 5:43966157-43966179 CCCTAATGGCTTCCCTTGGCTGG + Intergenic
990538303 5:56746592-56746614 GCCCAATCCCTACACCTGGCAGG + Intergenic
993460233 5:88173336-88173358 CCCTAATGGCTTCCCTTGGCTGG + Intergenic
994484913 5:100379405-100379427 GCCCACTGCCTGCCCTGGGCTGG - Intergenic
997733383 5:136196341-136196363 GCCAAATGGCTCTCGCTGGCAGG - Intergenic
998007399 5:138666078-138666100 GGCCAATGGAAGCCACTGGCAGG - Intronic
998060677 5:139116450-139116472 GCCCCAGGTCTGCTCCTGGCTGG + Intronic
998340070 5:141409597-141409619 GCGCAATGGAGGCTCCTGGCGGG - Exonic
999195239 5:149777427-149777449 GGCCATTGGCAGCCCCTGCCCGG + Intronic
999295943 5:150459454-150459476 GCCCAATGGCTGGCAGTGCCAGG + Intergenic
1002350487 5:178579949-178579971 GGCCAATCGCTGCCCCTCTCTGG + Intronic
1002834482 6:854461-854483 AACCAGTGACTGCCCCTGGCAGG - Intergenic
1005963815 6:30712333-30712355 GTATAATGGCTGACCCTGGCGGG + Exonic
1005988844 6:30891098-30891120 GCTCTATGGCTGCCTCTGGAGGG + Exonic
1006393980 6:33775101-33775123 ACCCAATTCCTGGCCCTGGCAGG - Intronic
1006680831 6:35795853-35795875 GCTGACTGGCTGCTCCTGGCAGG - Exonic
1007263488 6:40580226-40580248 GCCCATGGGCTGCCCCAGGGTGG + Intronic
1008147671 6:47911331-47911353 GCCCAAGAGCTGCCCTTGGGTGG - Intronic
1013564959 6:111348885-111348907 GCTCAAGGGATGCCCCTGCCTGG + Intronic
1014098589 6:117484950-117484972 CCCCAATGCCTGGACCTGGCTGG - Intronic
1019171691 6:170136547-170136569 GCCCAAGGCCTGCCGCAGGCGGG - Intergenic
1019304652 7:327524-327546 GCCCACTGGCTGCCCCATGGTGG + Intergenic
1019647058 7:2136595-2136617 GCCCAAAGCCTGCCCCTTCCAGG + Intronic
1020024398 7:4888634-4888656 GCCCAGTCTCTGCCCCTGGACGG - Intergenic
1021640199 7:22729101-22729123 CCTCTCTGGCTGCCCCTGGCAGG + Intronic
1022508751 7:30922292-30922314 TCCCACTGGCTGCCCATGGCAGG - Intronic
1025731929 7:64115026-64115048 GCCCCCTGGCTGCCCTGGGCTGG + Intronic
1028029357 7:85889971-85889993 GCCCAGTGGCTACCTCTGACGGG - Intergenic
1030533970 7:110743703-110743725 CCCTAATGGCTTCCCTTGGCTGG - Intronic
1030612704 7:111706419-111706441 CCCTAATGGCTTCCCTTGGCTGG + Intergenic
1030703150 7:112662787-112662809 CCCTAATGGCTTCCCTTGGCTGG + Intergenic
1032328104 7:130951102-130951124 TCCAAAAGGCTGGCCCTGGCAGG + Intergenic
1037803031 8:22045295-22045317 GCCCAATGGCTGCCCCTGGCAGG - Intronic
1039776130 8:40738605-40738627 GGCTATTGGCTGCCCCTTGCTGG - Intronic
1040298607 8:46176280-46176302 ACCCCAGGGCTGTCCCTGGCGGG + Intergenic
1040314386 8:46253300-46253322 CCCCTAAGGGTGCCCCTGGCAGG + Intergenic
1040316061 8:46261475-46261497 CCCCCAGGGCTGTCCCTGGCGGG + Intergenic
1040329717 8:46379641-46379663 CCCTTATGGCTGTCCCTGGCGGG + Intergenic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1040333269 8:46403202-46403224 GCCCCAGGGCTGCCCTGGGCAGG + Intergenic
1040341504 8:46443455-46443477 GCCCCATGGCTGACCCGGGCAGG - Intergenic
1040341891 8:46445261-46445283 TCCCAAGGGCTGTCCCAGGCTGG - Intergenic
1040342523 8:46448166-46448188 TCCCCATGGCTATCCCTGGCGGG - Intergenic
1040943110 8:52852869-52852891 CCCTAATGGCTTCCCTTGGCTGG + Intergenic
1044613817 8:94119721-94119743 TCCCAATGCCTGCCCCAGGGTGG + Intergenic
1049420642 8:142515069-142515091 CACCAATGGCTTCTCCTGGCTGG - Intronic
1049446838 8:142635120-142635142 GCCCACTGGCTGCCCGGGGCTGG + Intergenic
1049471397 8:142776514-142776536 GCCGGATGGCTGGCCATGGCAGG + Intronic
1049756054 8:144311800-144311822 GCCCCATGGCCTCCCCCGGCGGG + Exonic
1050112167 9:2228285-2228307 GCCCATTGGGTACCCCTGGGGGG + Intergenic
1050450770 9:5779415-5779437 CCCTAATGGCTTCCCTTGGCTGG - Intronic
1053391962 9:37742272-37742294 GCACAATGGCTGGCCCTGCAGGG - Intronic
1054785147 9:69203191-69203213 GCCCATGGGCTGAACCTGGCTGG + Intronic
1055645383 9:78357477-78357499 GCCCAAAGTCTGCCCATGGAGGG - Intergenic
1056578335 9:87872420-87872442 GCACACAGGCAGCCCCTGGCTGG + Intergenic
1056921016 9:90789394-90789416 GCCCAAGGCCTGCCCCTGCTGGG - Intergenic
1058314457 9:103547350-103547372 GCCCAATACCTTTCCCTGGCTGG + Intergenic
1059427103 9:114228072-114228094 GCCCATGGGATGCCCATGGCAGG + Intronic
1060754781 9:126204511-126204533 ACCCACTGGCTGCCCCAGGTAGG + Intergenic
1060855037 9:126908294-126908316 ACCCAATGACTGACCATGGCAGG - Intergenic
1061128331 9:128690110-128690132 GCCCAGAGGCTGGCCCCGGCGGG + Intronic
1061284427 9:129613998-129614020 CCCCAATGGCTGCCCCAGGATGG + Intronic
1061489553 9:130937719-130937741 GCCCCAGGGCTGCCCCAGGCTGG - Intronic
1062116020 9:134809309-134809331 GACCCATGGCTGGGCCTGGCTGG + Intronic
1062265964 9:135686666-135686688 ACATAAAGGCTGCCCCTGGCTGG + Intergenic
1186638113 X:11427674-11427696 GCCCAGGGGCTGCCCCAGGATGG - Intronic
1188009813 X:25043667-25043689 GCCCCTTGGCTGCCCCTGAGAGG - Intergenic
1188520212 X:31030263-31030285 GGCCAGTGGCTGCCCCTGGGAGG + Intergenic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1190054949 X:47175931-47175953 GCCCCAGGGCTGCCTCTGCCGGG - Intronic
1191787679 X:64934756-64934778 CCCTAATGGCTTCCCTTGGCTGG - Intronic
1194193573 X:90865604-90865626 GCACACTGGCTGCCCCTTGGTGG - Intergenic
1195232414 X:102863690-102863712 GCACACTGGCAGCCCGTGGCAGG - Intergenic
1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG + Intronic
1200134977 X:153870411-153870433 GACCAATGGCTGCCCCTGCAAGG + Exonic
1200540185 Y:4447986-4448008 GCACACTGGCTGCCCCTTGGTGG - Intergenic
1201394823 Y:13537037-13537059 CCCTAATGGCTTCCCTTGGCTGG + Intergenic