ID: 1037803137

View in Genome Browser
Species Human (GRCh38)
Location 8:22045781-22045803
Sequence TATTCTATGAAGGAGGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037803137_1037803143 1 Left 1037803137 8:22045781-22045803 CCGTGCACCTCCTTCATAGAATA 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1037803143 8:22045805-22045827 GAGGACGGGATAGAACCCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1037803137_1037803144 2 Left 1037803137 8:22045781-22045803 CCGTGCACCTCCTTCATAGAATA 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1037803144 8:22045806-22045828 AGGACGGGATAGAACCCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037803137 Original CRISPR TATTCTATGAAGGAGGTGCA CGG (reversed) Intronic
902888623 1:19425200-19425222 CATTGTATGAAGGAGGTGCCTGG - Intronic
906940445 1:50251095-50251117 TATTCTCAGTAGGAGGTGAAGGG - Intergenic
911249679 1:95560521-95560543 CATTATATGAAGGTGGAGCAAGG - Intergenic
911269599 1:95784652-95784674 TATTCAATGATGAAGTTGCATGG - Intergenic
915035681 1:152922091-152922113 TATTCACTGAAGGATCTGCAGGG - Intergenic
917583740 1:176404016-176404038 TATTCTGTGAAGGATGTCAATGG + Intergenic
920432199 1:205926230-205926252 TTTTCTATGAAGAAGAAGCAAGG - Intronic
922565380 1:226598076-226598098 GATCCCATGAAGGAGATGCAAGG - Intronic
923219227 1:231878117-231878139 TATTCTATCAGGCAGGTGCTGGG + Intronic
924742387 1:246802651-246802673 AATTCAAGGAAGGAGGTGCCAGG + Intergenic
924790026 1:247237481-247237503 TTTTCCAAGAAGGAGGTGCTGGG + Intergenic
1064426774 10:15236417-15236439 AATTCTATGAGGGAGGGGCTGGG + Intronic
1068114638 10:52723893-52723915 TACCCTTTGAAGGAGGTGGATGG + Intergenic
1071652722 10:87409566-87409588 TATTCTAGGAATGATCTGCAAGG + Intergenic
1072088503 10:92103976-92103998 TATTCTTTGAATGAGCTTCATGG + Intronic
1074529174 10:114285304-114285326 TATTCTATGAAAGCAGAGCAAGG + Intronic
1075505259 10:123015605-123015627 TACTCCATGAAGGAGGGGAAAGG + Intronic
1075828163 10:125378415-125378437 TACCTTATGAAGGTGGTGCATGG + Intergenic
1077169760 11:1160899-1160921 TAGGCTCTGAAGGAGCTGCAGGG + Intronic
1077995969 11:7453080-7453102 TATTCTTTAAAGGAGTTTCAGGG - Intronic
1078160775 11:8837905-8837927 GAGTTTATGAAGGAGGTGGAAGG + Intronic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1081166489 11:39814541-39814563 AATTCTATGAAGAAAGTGAATGG - Intergenic
1084812705 11:71624456-71624478 CATTGTATGAAGGAACTGCAGGG - Intergenic
1087620169 11:100531730-100531752 AATTCTATGAAGGATGTCAATGG - Intergenic
1088690951 11:112327139-112327161 AATTCTATGAAGAAAGTCCATGG + Intergenic
1091225180 11:133952896-133952918 TCTTCTAGGAAGCAGGTGGAAGG + Intronic
1091622554 12:2100355-2100377 AATTCCTTGAAGGAGGTTCAAGG + Intronic
1094392588 12:29967982-29968004 TATTCTATGAAGGAGGTTTCTGG + Intergenic
1095819287 12:46459824-46459846 TTTTCTATGCAGGAGGGGGATGG + Intergenic
1106882461 13:34146723-34146745 TATTTCATGAATGAAGTGCAAGG + Intergenic
1109194908 13:59367948-59367970 TTTCCTATTAAGTAGGTGCATGG + Intergenic
1109248152 13:59983705-59983727 TATTCTATGAATGAGCTCTAGGG - Intronic
1110306278 13:73990822-73990844 TATTCTTTGTAAGAGATGCAAGG + Intronic
1110548080 13:76779226-76779248 GATTCTATGATGAAGGTGGAAGG - Intergenic
1110804670 13:79740033-79740055 AAATCTATGAGGAAGGTGCAAGG - Intergenic
1111184059 13:84706071-84706093 TCTTCTATGAAGCAGTTGCTGGG - Intergenic
1111224594 13:85252863-85252885 AATTCTATGAAGAAGGTCAATGG + Intergenic
1116035642 14:39624008-39624030 TATTCTGTGAAGAAGGTCAATGG + Intergenic
1116521135 14:45848499-45848521 TATTCTATGGCAGAGGTGAAAGG - Intergenic
1117014114 14:51501034-51501056 TATGCTAGGAAGGAGGAACAGGG - Intronic
1118678797 14:68217464-68217486 TACTCTATGATGCGGGTGCATGG + Intronic
1118914162 14:70087779-70087801 TATTTTATAAAAGACGTGCATGG + Intronic
1120210673 14:81630595-81630617 TAGTCTCTGAGGGAGGTGCCTGG + Intergenic
1125925368 15:43558734-43558756 TATTCTAGGAAGCATGGGCATGG + Intronic
1125974451 15:43938842-43938864 TAATCTATTAAGGATGAGCATGG - Intronic
1126784749 15:52168583-52168605 TATTCTATGAAGAATGTCAATGG - Intronic
1127135602 15:55919673-55919695 AATTCTATGTAGGACTTGCATGG - Intronic
1129613654 15:77081697-77081719 TATTCCAAGAGGGAGGCGCAGGG + Intronic
1133035087 16:3029892-3029914 TATCCGCTGAGGGAGGTGCACGG - Intronic
1133381726 16:5336569-5336591 TATCCTCTGGAGTAGGTGCAGGG + Intergenic
1133443788 16:5842646-5842668 CATTCTTTGAAGGAAGAGCATGG - Intergenic
1133647862 16:7781196-7781218 CATTCTGTGGAGGATGTGCATGG + Intergenic
1134188530 16:12103169-12103191 AATTCTGTGAAGAAAGTGCATGG - Intronic
1138528244 16:57620942-57620964 TGTTCCATGAAGGAGAGGCAGGG + Intronic
1139276811 16:65735562-65735584 GATCCCATGAAGAAGGTGCAAGG + Intergenic
1139402059 16:66690517-66690539 TGTTCTCTGGAGGATGTGCAGGG - Intronic
1140351250 16:74263803-74263825 TATTCCATGAAGTGTGTGCAGGG + Intergenic
1141399305 16:83733217-83733239 TGTTCTGTGAAGGAGCTGGAGGG - Intronic
1143850082 17:9804373-9804395 TATTCTCTGGAGAAGGTGAACGG + Intronic
1147388981 17:40097932-40097954 TATTCTCTGAAGGAAATGAAGGG + Intronic
1147865661 17:43550398-43550420 TTTTTTGTGGAGGAGGTGCAGGG + Intronic
1155682612 18:28507667-28507689 TATCCTAAGAAGGAGGGGCAAGG + Intergenic
1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG + Intergenic
1156892708 18:42208406-42208428 TATTCTTGGAAGTAGATGCAAGG + Intergenic
1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG + Intronic
1157723991 18:49948989-49949011 AATTCTGGGAAGGAGGTGTAGGG + Intronic
1159183374 18:64939773-64939795 TATTTTATAAAGATGGTGCATGG - Intergenic
1159933451 18:74338519-74338541 TATTGTATAAAGGAGAAGCAGGG + Intronic
1160207775 18:76850292-76850314 TGTTCTCTAAAGGAGGTCCATGG - Intronic
1163373201 19:16914120-16914142 GATTCTCTGAAGGAGGTCTAGGG + Intronic
1163790214 19:19302046-19302068 TAGTCTCTGAGGCAGGTGCACGG - Intronic
1167626158 19:50590888-50590910 AATTTTAAGAAGGAGGTTCATGG - Intergenic
1168427099 19:56247524-56247546 TATGACATGAAGCAGGTGCAAGG + Intronic
925610048 2:5694899-5694921 TATTCAATCAAGGAGGTATAAGG - Exonic
928942689 2:36742538-36742560 TGTTCTATGTAGGATGTGGAAGG - Intronic
939766234 2:146253122-146253144 TATTCTATAACAGTGGTGCATGG + Intergenic
939909897 2:147967576-147967598 AATTCAATTAAGGAGGTGAAAGG + Intronic
942836540 2:180305664-180305686 TATGCCTTAAAGGAGGTGCATGG + Intergenic
942876830 2:180810455-180810477 TATTCTGTGAAGCAGATACAGGG - Intergenic
944544688 2:200787684-200787706 GATTCTATGAAGGACAGGCATGG - Intergenic
947832812 2:233153747-233153769 TATTCTTTGGAGAAGGTGAAGGG + Intronic
948395776 2:237643959-237643981 TATTACATGAAGGAGGGGTAAGG - Intronic
1169098783 20:2927637-2927659 TTTTCTTTGACGGGGGTGCAGGG + Intronic
1171912050 20:30971977-30971999 TATTCTATGAAGAAAGTGATTGG + Intergenic
1175942789 20:62545659-62545681 TATTCAGTGGGGGAGGTGCACGG - Intergenic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1177641952 21:23855064-23855086 TAATCTGAGAAGGAGGTGCAAGG + Intergenic
1178635824 21:34302276-34302298 TATGCTATGAAGGAAATGCTTGG + Intergenic
1181371510 22:22422156-22422178 AATTCAAGGAAGGAGGTACATGG + Intergenic
1183297926 22:37043133-37043155 TGTCCCATGGAGGAGGTGCATGG + Intergenic
1184013142 22:41764604-41764626 TATTCTATGAAATAGGTGAGAGG + Intronic
949408150 3:3735962-3735984 TATTCTAGGAAGAATGGGCAAGG + Intronic
949724349 3:7026065-7026087 TATCCTAAGCAAGAGGTGCAGGG + Intronic
951361227 3:21726787-21726809 TATTCTATGAAGAAAGTCAATGG - Intronic
953325055 3:42006084-42006106 TATTCTATGATGGCTGGGCACGG + Intergenic
955385428 3:58475535-58475557 CATGCAATGAAGGGGGTGCAGGG - Intergenic
957976350 3:87450073-87450095 TATTCAATGGAAGAGATGCAAGG - Intergenic
961434918 3:126910304-126910326 TTTTCAGTGAAGGAGGGGCAGGG - Intronic
961905962 3:130263781-130263803 TTGTCTAGGAAGGAAGTGCAGGG - Intergenic
965391740 3:168112605-168112627 TGTTTTATGAAGCAGGTACAGGG + Intergenic
973982857 4:56320820-56320842 TATTTTATGAAGCTGGTGGAAGG - Intronic
974618699 4:64326167-64326189 TATTGTATAAAGGATGTGGATGG + Intronic
975199462 4:71568876-71568898 TGTTCTATGAAGGAGATTGAGGG + Exonic
975760336 4:77613898-77613920 AACTGAATGAAGGAGGTGCATGG + Intergenic
979452067 4:120884720-120884742 TGTTCTTTGAAGGAGGAGGATGG - Intronic
980471817 4:133262864-133262886 GATTCTCTGGAGGGGGTGCACGG + Intergenic
981297092 4:143144973-143144995 AATTCTGTGAAGGAAGTCCATGG - Intergenic
982547469 4:156752658-156752680 TATTCTAAGAAGTAGCTGCCTGG - Intergenic
983169238 4:164517122-164517144 TATTCTATGAAGAATGTAAATGG + Intergenic
983402701 4:167285487-167285509 AATTCTATGAAGAATGTGAATGG + Intergenic
983403446 4:167295115-167295137 TATGCTAGGAAGGAGGAGCCTGG - Intergenic
987135749 5:14897921-14897943 GATGCTGTGAAGGTGGTGCAAGG - Intergenic
989416799 5:41187557-41187579 TTTTCTATCAAAGAGGAGCAAGG + Intronic
989626865 5:43438057-43438079 TCATCTAAGAAGGAGGTACAGGG + Intergenic
993844129 5:92918933-92918955 TATCATATTATGGAGGTGCATGG + Intergenic
995119907 5:108525044-108525066 AATGCTATGAAGGAAATGCATGG + Intergenic
995271087 5:110220306-110220328 TTTTCCATGAAGAAGCTGCATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
1001033026 5:168276496-168276518 CAATCTATGACGGGGGTGCAGGG + Intergenic
1003578602 6:7319316-7319338 TTTTCTATGAAGTATGTGCTGGG - Intronic
1004329388 6:14707893-14707915 TATTCGGTGAAGGAGGAGAAGGG - Intergenic
1007908860 6:45492412-45492434 TATTGTATCCAGGTGGTGCAGGG + Intronic
1009716189 6:67399379-67399401 AATTCTGTGAGGGACGTGCAGGG - Intergenic
1010964156 6:82183922-82183944 TATGCTATGAAGCAGGAACAAGG + Intronic
1011479614 6:87781000-87781022 TATTATATGAAGGACATGTAAGG + Intergenic
1012015728 6:93848061-93848083 TATTTTATGGAGCAGCTGCAGGG + Intergenic
1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG + Intergenic
1012521361 6:100124980-100125002 TATTATATTAAAGAGATGCACGG + Intergenic
1014279256 6:119422553-119422575 AATTCTATGAAGAAGGTTAATGG - Intergenic
1015541590 6:134319711-134319733 TCTGCTAGGAAGGAGGTGCTGGG + Intergenic
1016148138 6:140702063-140702085 AATTCTATGAAGAAGGTCAATGG + Intergenic
1017130692 6:151106199-151106221 TATTCTAAGAAGGGGGTCCATGG + Intergenic
1020739340 7:11993615-11993637 TATCCTATGAAGGAGCACCATGG - Intergenic
1024696527 7:51862348-51862370 TATGCAATGAAAAAGGTGCATGG - Intergenic
1028672383 7:93417986-93418008 TACTCTATCAAGGAGTTGCAGGG - Intergenic
1030424424 7:109356139-109356161 TATTTTATGGAAGAGATGCAGGG - Intergenic
1035200285 7:157259254-157259276 GATTCTATGAAGGACGCGAAGGG - Intronic
1036627740 8:10485551-10485573 TATTCTATCAAAAAGGTGCTTGG - Intergenic
1037803137 8:22045781-22045803 TATTCTATGAAGGAGGTGCACGG - Intronic
1040023569 8:42761779-42761801 TTTTCCAAGAAGGAGGTACAGGG - Intronic
1042857417 8:73281761-73281783 TATTCTCTGGAGGAGGAGCCAGG - Intergenic
1046212676 8:111098973-111098995 TATTCTATCAAGAAATTGCATGG - Intergenic
1047636639 8:126770652-126770674 TATTCTATTAAGGAGAACCAAGG + Intergenic
1047673169 8:127171201-127171223 TATTCTAAGAAGGAACAGCAAGG - Intergenic
1048464849 8:134656880-134656902 TATCCGATGCAGCAGGTGCACGG - Intronic
1050931990 9:11340658-11340680 TATTATATAAAGCAGATGCAGGG - Intergenic
1056624081 9:88239301-88239323 TAGTTTATTCAGGAGGTGCAGGG - Intergenic
1059895539 9:118860227-118860249 AATTCTGTGAAGAATGTGCATGG - Intergenic
1062707425 9:137953223-137953245 TGTGCTAGGAAGGAGGTGGAAGG + Intronic
1186201738 X:7162366-7162388 TATTATGAGAAGGAAGTGCAGGG + Intergenic
1189607551 X:42695803-42695825 TAGCTTATTAAGGAGGTGCAGGG + Intergenic
1193848195 X:86501205-86501227 TATTCTTGGAAGGAGGCCCAAGG + Intronic
1202049287 Y:20763965-20763987 TATTCAATGATGGATGTGCATGG + Intronic
1202331158 Y:23754517-23754539 AATTCTTTGAAGGAGCTGCAAGG - Intergenic
1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG + Intergenic